We narrowed to 15,280 results for: grn
-
-
-
PX458_MIER3_2
Plasmid#86324PurposeEncodes gRNA for 3' target of human MIER3DepositorPublicationInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RFXANK_2
Plasmid#86365PurposeEncodes gRNA for 3' target of human RFXANKDepositorPublicationInsertgRNA against RFXANK (RFXANK Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_RFXANK_1
Plasmid#86364PurposeEncodes gRNA for 3' target of human RFXANKDepositorPublicationInsertgRNA against RFXANK (RFXANK Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_1
Plasmid#86323PurposeEncodes gRNA for 3' target of human MIER3DepositorPublicationInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KAT7_1
Plasmid#86309PurposeEncodes gRNA for 3' target of human KAT7DepositorPublicationInsertgRNA against KAT7 (KAT7 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2 FAM83H
Plasmid#258456PurposeCRISPR-mediated knock-out of human FAM83HDepositorInsertFAM83H sgRNA
UseLentiviralExpressionMammalianPromoterU6Available sinceJuly 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2 Scramble
Plasmid#258450PurposeControl for CRISPR-mediated knock-outDepositorInsertScramble sgRNA
UseLentiviralExpressionMammalianPromoterU6Available sinceJuly 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSR3036
Plasmid#222629PurposeSp-dCas9 CRISPRi plasmid targeting yejL (b2187) in E. coli MG1655DepositorInsertgRNA spacer sequence targeting yejL
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPTacAvailable sinceJune 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSR3039
Plasmid#222630PurposeSp-dCas9 CRISPRi plasmid targeting ompF (b0929) in E. coli MG1655DepositorInsertgRNA spacer sequence targeting ompF
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPTacAvailable sinceJune 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSR3030
Plasmid#222627PurposeSp-dCas9 CRISPRi plasmid targeting ompR (b3405) in E. coli MG1655DepositorInsertgRNA spacer sequence targeting ompR
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPTacAvailable sinceJune 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSR3034
Plasmid#222628PurposeSp-dCas9 CRISPRi plasmid targeting lapC (b2188) in E. coli MG1655DepositorInsertgRNA spacer sequence targeting lapC
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPTacAvailable sinceJune 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE1643
Plasmid#219650PurposeGeneration of nonsense mutation W241* in DesD, disrupting desferrioxamine biosynthesis by base editing CRISPRDepositorInsertgRNA targetting desD in Streptomyces
UseCRISPRAvailable sinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-ZNF865-UbC-DsRed-P2A-Bsr
Plasmid#241309PurposeLentiviral SpCas9-gRNA (ZNF865) expression vector with DsRed-Express2-P2A-BlastRDepositorInsertZNF865 gRNA (ZNF865 Human)
UseLentiviralAvailable sinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable sinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgNon-targeting
Plasmid#233244PurposeKnock out - non targeting controlDepositorInsertnon targeting control sgRNA
UseLentiviralAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ105
Plasmid#208859PurposeExpresses SoxS activation domain and gRNA targeting 105 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 105
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only
