We narrowed to 11,396 results for: ENA
-
Plasmid#103761PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-96-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only
-
LSB-hsa-miR-126-5p
Plasmid#103193PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-126-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-126-5p target (MIR126 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-200c-3p
Plasmid#103332PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-200c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-200c-3p target (MIR200C Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-2-3p
Plasmid#103155PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-2-3p target (MIRLET7F2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-MCART1W283A
Plasmid#138409PurposeExpress FLAG-tagged MCART1W283A in mammalian cellsDepositorInsertSLC25A51 (SLC25A51 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationcodon-optimized for expression in human cells, W2…Available SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-93-3p
Plasmid#103755PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-93-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECE M2-SH3PXD2A 8 serines mutated to alanines
Plasmid#69816PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-130b-5p
Plasmid#103218PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-130b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-130b-5p target (MIR130B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-152-3p
Plasmid#103260PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-152-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-152-3p target (MIR152 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only