We narrowed to 5,947 results for: crispr cas9 expression plasmids
-
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ165
Plasmid#109327PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS driven by egg cell-specific promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterPromoter EC1.2 enhancer fused to EC1.1 promoterAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
Tags10xHis-MBP-TEVExpressionBacterialAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only