We narrowed to 1,903 results for: sfGFP
-
Plasmid#194154PurposeGreen Fluorescent Reporter of intracellular hydrogen peroxideDepositorInserttranscriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
ExpressionBacterialPromoterPoxyR, PoxySAvailable sinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Prdm9CD-CatMut
Plasmid#235586PurposeDox-inducible expression of control catalytic-mutant Prdm9 CD fused with scFVDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPrdm9 (Prdm9 Mouse)
UseCRISPRMutationG282AAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Ezh2FL-CatMut
Plasmid#235584PurposeDox-inducible expression of control catalytic-mutant Ezh2 fused with scFVDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEzh2 (Ezh2 Mouse)
UseCRISPRMutationY726DAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-sfGFP (TB40/E)
Plasmid#136451PurposeMammalian expression plasmid for HCMV glycoprotein O (TB40/E strain) fused to superfolder GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsGly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBMN-FKBP DD(L106P)-UbK0G75C-sfGFP
Plasmid#172001PurposeExpression for LIBRON constructsDepositorInsertFKBP DD (L106P)-UbK0G75C
UseRetroviralTagssfGFPMutationchange all lysin residues of ubiquitin to Arg, G7…Available sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
Annexin V-sfGFP
Plasmid#257992PurposeBacterial expression of fluorescent Annexin VDepositorAvailable sinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSub-MBP-GFP(2M-IKQE)
Plasmid#185757PurposeBacterial expression of MBP-GFP(2M IKQE)DepositorInsertGFP(2M-IKQE)
TagsMBPExpressionBacterialPromotertacAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH26_pBad_AraC_Para-sfGFP.1TAG
Plasmid#163721PurposeArabinose-inducible expression of green fluorescent protein encoding one amber codonDepositorInsertaraC gfp.1TAG
ExpressionBacterialMutationgfp.N39TAGAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-SP-FRB (T2098L) -sfGFP-TM-V5
Plasmid#186227PurposemRNA synthesis of rapalog-induced cell adhesion moleculeDepositorInsertmRNA synthesis of rapalog-induced cell adhesion molecule
TagsV5ExpressionMammalianMutationFRB (T2098L)Available sinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNB-Rep
Plasmid#238996PurposeNode B carrying the sfGPF reporter that can be used for the assembly of pEND-11Y, pEND-Y11, pEND-Z11 or pEND-ZYDepositorInsertsfGFP-MarAn10 downstream of a strong constitutive promoter and a binding site for sgRNA-1
UseSynthetic BiologyExpressionBacterialMutationWTAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-11Y
Plasmid#238999PurposeFinal circuit with -Ara: OFF, +Ara: OFF behaviourDepositorInsertCircuit with no sfGFP expression (-Ara: OFF, +Ara: OFF)
UseSynthetic BiologyExpressionBacterialMutationWTAvailable sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-Z11
Plasmid#239001PurposeFinal circuit with -Ara: ON, +Ara: ON behaviourDepositorInsertCircuit with sfGFP expression (-Ara: ON, +Ara: ON)
UseSynthetic BiologyExpressionBacterialMutationWTAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK123 [Misc_Expanding-Modulator-B_PartType8-11]
Plasmid#229360PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Misc_Expanding-Modulator-B_PartType8-11DepositorInsertExpanding Modulator B (sfGFP)
ExpressionBacterialAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK125 [Misc_Terminating-Modulator-B_PartType8-11]
Plasmid#229362PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Misc_Terminating-Modulator-B_PartType8-11DepositorInsertTerminating Modulator B (sfGFP)
ExpressionBacterialAvailable sinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY315
Plasmid#184160PurposeReporter circuit for hijacking mRNA of zntA as CRISPR RNADepositorInsertsdCas9
tetR
pspFΔHTH::λN22plus
sfgfp
rhaS
UseSynthetic BiologyTagsASV tag and λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPcon, PpspA-zntA-1034, PrhaB, and PtetAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY162
Plasmid#184138PurposeReporter circuit for hijacking RFP mRNA as CRISPR RNA (target site 1)DepositorInsertsdCas9
tetR
pspFΔHTH::λN22plus
sfgfp
rhaS
UseSynthetic BiologyTagsASV tag and λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPcon, PpspA-R1, PrhaB, and PtetAvailable sinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only