We narrowed to 1,869 results for: sfGFP
-
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pASPIre3
Plasmid#154844PurposeDerivative of pASPIre2 lacking mCherry but containing a silent 150 bp DNA spacer flanked by attB/P sites; main uASPIre plasmid used in this studyDepositorInsertBxb1-sfGFP fusion controlled by rhamnose-inducible promoter; attB/attP-flanked silent discriminator
ExpressionBacterialAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7
Plasmid#180315Purposemammalian expression of human SEPT7 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cx30-msfGFP
Plasmid#69019PurposeExpresses human Cx30 (GJB6 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRC072
Plasmid#225982PurposeJ23110_buj_sfGFP_buj_mRFPDepositorInsertsfGFP (with buj RBS), mRFP (with buj RBS)
ExpressionBacterialPromoterJ23110Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPS0383
Plasmid#133233PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJH776_pJH_LldR_PlldR-sfGFP.3opal
Plasmid#163735PurposeLactate-inducible expression of green fluorescent protein encoding three opal codonsDepositorInsertlldr gfp.3TGA
ExpressionBacterialMutationgfp with first three leucine codons mutated to am…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH807_pJH_LldR_Pcon-sfGFP.2TAG
Plasmid#163738PurposeConstitutive expression of green fluorescent protein encoding two stop codonsDepositorInsertlldr gfp.2TAG
ExpressionBacterialMutationgfp.N39TAG,Y135TAGAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH809_pJH_LldR_Pcon-sfGFP.10TAG
Plasmid#163739PurposeConstitutive expression of green fluorescent protein encoding ten stop codonsDepositorInsertlldr gfp.10TAG
ExpressionBacterialMutationgfp with first 10 leucine codons mutated to amberAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH27_pBad_AraC_Para-sfGFP.2TAG
Plasmid#163722PurposeArabinose-inducible expression of green fluorescent protein encoding two amber codonsDepositorInsertaraC gfp.2TAG
ExpressionBacterialMutationgfp.N39TAG,Y151TAGAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH628_pJH_LldR_PlldR-sfGFP.3TAG
Plasmid#163727PurposeLactate-inducible expression of green fluorescent protein encoding three amber codonsDepositorInsertlldr gfp.3TAG
ExpressionBacterialMutationgfp.N39TAG,N135TAG,Y151TAGAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH726_pJH_LldR_PlldR-sfGFP.15TAG
Plasmid#163730PurposeLactate-inducible expression of green fluorescent protein encoding fifteen amber codonsDepositorInsertlldr gfp.15TAG
ExpressionBacterialMutationgfp with first 15 leucine codons mutated to amberAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH25_pBad_AraC_Para-sfGFP.0TAG
Plasmid#163720PurposeArabinose-inducible expression of green fluorescent protein encoding zero amber codonsDepositorInsertaraC gfp
ExpressionBacterialAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-125b-2.PGK.sfGFP.P2A.Tet3G
Plasmid#169315PurposeDoxycycline-inducible expression of miR-125b-2 with dTomato as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-pMJ915v2-sfGFP
Plasmid#88920PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
1xNLS-pMJ915v2-sfGFP
Plasmid#88919PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-sfGFP (Merlin)
Plasmid#136452PurposeMammalian expression plasmid for HCMV glycoprotein O (Merlin strain) fused to superfolder GFPDepositorInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsGly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-HaloTag-V5-EF1-sfGFP
Plasmid#182565PurposeFor mouse Nav1.6 knockin with HaloTag-V5 at the C-terminalDepositorInsertsmouse Scn8a gRNA and HaloTag-V5 donor DNA
sfGFP
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cx26-msfGFP
Plasmid#69016PurposeExpresses rat Cx26 (Gjb2 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only