We narrowed to 46,018 results for: cha
-
Plasmid#145373Purposeexpresses mutant form of human Nav1.5 (L325R) found in patient with Brugada syndrome in mammalian cellsDepositorInsertsodium voltage-gated channel alpha subunit 5 (SCN5A Human)
ExpressionMammalianMutationchanged Leucine 325 to ArgininePromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD0035_CROPseq-CAR-Puro_CD19-28z
Plasmid#242983PurposeCD19-28z FMC63 CARDepositorInsertCD19-28z FMC63 CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLS-P2A-Puro
Plasmid#110841PurposeLentiviral vector for constitutive expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
COVID-SARS2 NSP13
Plasmid#159614PurposeBacterial expression plasmid for COVID-SARS2 NSP13 helicaseDepositorInsertCovid-SARS2 Nsp13
TagsHis6-Zb-TEVExpressionBacterialMutationCodon-optimized for E. coli expressionPromoterT7 - LacOAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human_TFAM_NoMTS_L6_pET28a+
Plasmid#60012PurposeExpresses TFAM No MTS L6 mutant in bacterial cellsDepositorInsertHuman TFAM No MTS (TFAM Human)
Tags6xHisExpressionBacterialMutationMissing 1st 42 aas (Mitochondrial targeting seque…PromoterT7Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-SOX4
Plasmid#110360PurposeMammalian expression of FLAG-tagged SOX4DepositorAvailable SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Orf3a-mCherry
Plasmid#165138Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HA
Plasmid#242768PurposeAAV transfer plasmid expressing eGFP-HA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHAPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only