We narrowed to 10,114 results for: Coli
-
Plasmid#67012PurposeExpresses malE-ELP[AV-60] in E. coliDepositorInsertmalE-ELP[AV-60]
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKFSS1_2
Plasmid#118227PurposeEmpty E. coli - B. burgdorferi shuttle vector; streptomycin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSG22-pBAD-TetR
Plasmid#102451PurposeExpresses TetR protein in E. coli. The expression is controlled by a pBAD promoter.DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOGG005
Plasmid#113980PurposeLevel 1 high copy number vector for E. coli expressionDepositorTypeEmpty backboneExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)
Plasmid#205045PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a human Tankyrase2 full length Y920E
Plasmid#132639Purposeexpresses human Tankyrase2 full length Y920E in E. coliDepositorInsertTankyrase2 Y920E
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only