We narrowed to 3,108 results for: N-EGFP
-
Plasmid#214870PurposeExpression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs)InsertCoChR-EGFP
UseAAVTagsExpressionMutationPromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP15457 - pAAV-AiE0441h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5457)
Plasmid#224198PurposeAiE0441h_3xC2 is an enhancer sequence, designed to drive AAV-mediated transgene expression in striatal MSNsInsertCoChR-EGFP
UseAAVTagsExpressionMutationPromoterAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP14034: pAAV-AiE0445h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4034)
Plasmid#230866PurposeAiE0445h_3xC2 is an enhancer sequence, designed to drive AAV-mediated transgene expression in striatal indirect pathway MSNs (D2-MSNs)InsertCoChR-EGFP
UseAAVTagsExpressionMammalianMutationPromoterAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15140: pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140)
Plasmid#214869PurposeExpression of CoChR-EGFP in striatal cholinergic neuronsHas ServiceAAV PHP.eBInsertCoChR-EGFP
UseAAVTagsExpressionMutationPromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP14036: pAAV-AiE0743m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4036)
Plasmid#214854PurposeExpression of CoChR-EGFP in striatal cholinergic neuronsInsertCoChR-EGFP
UseAAVTagsExpressionMutationPromoterAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-TAX1BP1
Plasmid#175766PurposeLentiviral vector expressing N-terminally tagged eGFP-TAX1BP1DepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-eGFP-MinD
Plasmid#133622PurposeExpression vector for the Escherichia coli MinD with an N-terminal fusion of a His-tag for purification and an EGFP for visualization.DepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-DD-pEGFP-C1
Plasmid#177429PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, phosphomimetic mutant. T33D and S35D mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
UseTagsVenusExpressionMammalianMutationThreonine 33 and Serine 35 replaced with aspartic…PromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV-EGFP-C
Plasmid#13887DepositorInsertC domain of N-WASP (WASL Bovine)
UseAdenoviralTagsEGFPExpressionMutationThe BglII site in the MCS of pShuttle-CMV was fil…PromoterAvailable SinceFeb. 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-AA-pEGFP-C1
Plasmid#177430PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with 2 sites of phosphorylation mutated to alanine. T33A and S35A mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
UseTagsVenusExpressionMammalianMutationThreonine 33 and Serine 35 replaced with alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry2-CD86-mEGFP
Plasmid#190748PurposeExpression of CD86 double tagged with mCherry2 (N-term) and mEGFP (C-term) in mammalian cells.DepositorAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide1
Plasmid#118166PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide2
Plasmid#118167PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA2 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide3
Plasmid#118168PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA3 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2 LRP6-APEX2-Ires-eGFP-PAC
Plasmid#180142Purposeused to biotinylate targets that are recruited near the receptor during Wnt signaling at different time periodsDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CCM2_wt_eGFP
Plasmid#208876PurposeExpress eGFP-CCM2 in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_I432D_eGFP
Plasmid#208879PurposeExpress eGFP-CCM2 with the I432D mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_W421AD422A_eGFP
Plasmid#208880PurposeExpress eGFP-CCM2 with the W421A and D422A mutations in mammalian cells.DepositorInsertCCM2 (CCM2 Human)
UseTagseGFPExpressionMammalianMutationmutations W421A and D422APromoterAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only