Skip to main content
Addgene

We narrowed to 46 results for: N-EGFP

Showing: 1 - 20 of 46 results
  1. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ...three inactivated eGFP reporters- eGFP L202, eGFP L138, and eGFP L93. The modified eGFPs were placed downstream...comparing cells expressing only eGFP expression to cells expressing eGFP and mCherry. ACE was used to identify... To create the eGFP reporters the Harris lab individually mutated three codons in eGFP to eliminate fluorescence...editisome complexes. The eGFP reporters rely on the correction of point mutations in eGFP that results in the...mutated mCherry and a downstream constitutively active eGFP. To create the inactive mCherry, the lab introduced...fluorescence to monitor APOBEC-Cas-9 mediated editing. eGFP reporters for single base editing by APOBEC-Cas9...previous reporter, the Harris Lab created a panel of eGFP reporters to quantify the on-target DNA editing ...
  2. Plasmids 101: How to Name Your Plasmid in 3 Easy Steps

    Type
    Blog Post
    ...pBACKBONE-Flag-hGene(Q295A)-EGFP  Wildtype version: pBACKBONE-Flag-hGene-EGFP or pBACKBONE-Flag-hGene(wt)-EGFP These simple.... pBACKBONE-Flag-hGene If there was also an EGFP fused to the C-terminal of your insert you would list...list it after the insert. pBACKBONE-Flag-hGene-EGFP Other considerations  If your insert contains a mutation...the insert. Example, if you have a Flag tag on the N-terminal of your insert, you would list it first. ...
  3. Magnetic Control of Proteins: More than a Dream

    Type
    Blog Post
    ...protein they tested — E. coli expressing good ol’ EGFP — showed a slight but detectable change in fluorescence...better, multiple other labs have reproduced their EGFP findings since the initial report in 2023.)   ...   Figure 1: Fluorescence intensity of EGFP-FlavinTag in E. coli changes in response to a ~25 mT...proteins display a similar effect (many do). Fusing EGFP to the self-labeling FlavinTag made a reliable one-component... the proteins that had shown magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random... semi-random mutagenesis and screening, the EGFP and mScarlet variants were showing no obvious signs of...Polali, S., Anderson, E. D., Bell, A. M., Tzouanas, C. N., Avants, B. W., & Robinson, J. T. (2019). Magnetic...
  4. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon Harvey 50457 AAV2 pAAV-hSyn-DIO-EGFP Bryan Roth 50459 AAV1 pAAV-hSyn-DIO-mCherry...pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV...pAAV-hSyn-DIO-mCherry Bryan Roth 50457 AAV1 pAAV-hSyn-DIO-EGFP Bryan Roth 114472 AAVrg pAAV-hSyn-mCherry Karl...CRE-DOG constructs 69570 and 69571 together encode the N and C terminal segments respectively of a GFP dependent...Plasmid Serotype Name Depositor 69570 AAV1 pAAV-EF1a-N-CretrcintG Connie Cepko 69571 AAV1 pAAV-EF1a-C-CreintG...
  5. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...Addgene cloned EGFP into pAG Lenti CMV N-HA Puro (Addgene #236079) to create pAG Lenti CMV HA-EGFP Puro (Addgene...Sanchez, A. D., Udeshi, N. D., Svinkina, T., Carr, S. A., Feldman, J. L., Perrimon, N., & Ting, A. Y. (2018...excited to share our very own set of empty, HA-, and EGFP-expressing lentiviral backbones designed right here... packaging and strong expression after inserting EGFP and provide step-by-step protocols for viral generation...Figure 2). Looking for more? Explore our empty and EGFP retroviral plasmid set, our bacterial plasmid set...Flexible tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable: A puromycin...
  6. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...along with EGFP while retaining an emission spectrum that is easily separable from that of EGFP. This makes...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2...acrIIA3   Listeria monocytogenes  pCSW65 N/A (Toxic)   None N/A   acrIIA4 Listeria monocytogenes  pCSW21...and combined it with a variety of reporters (i.e. eGFP) and effectors (i.e. DREADDs). The team demonstrated...mCyFP1, the Lin and Yasuda groups use both mCyFP1 and EGFP as FRET donors in experiments simultaneously measuring...Gateway-Compatible Toolbox Podcast Segment The impact of KLF4 N-terminal variants on iPSC generation Deriving iPSCs...discrepancies, which they traced to a 9 amino acid N-terminal variation in the Klf4 isoform (KLF4s or KLF4L...
  7. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...Find FRET plasmids here. Split EGFP: An alternative to FRET, split EGFP has also been used to study protein-protein...Fluorescent Protein Mutations Relative to Wildtype GFP EGFP F64L; S65T EYFP S65G; V68L; S72A; T203Y mYFP...protein-protein interactions. In this case, two portions of EGFP are fused to the proteins of interest, and when ...they come into close proximity, the two halves of EGFP undergo folding, maturation, and fluorescence. Biosensors... egfp... of the most common uses, GFP can be fused to the N- or C-terminus of a protein, which allows the scientist...
  8. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

    Type
    Blog Post
    ... to LanYFP and the addition of the enhanced GFP (EGFP)-type termini. mNeonGreen was reported as the brightest...protein. In vitro, mWasabi is 1.6-fold brighter than EGFP and is photostable. It also has narrow excitation...it does not significantly excite at 400 nm while EGFP does. Find mWasabi plasmids here! One of the most...constructed 22 different mTFP1 fusions to both the C- and N- termini of the fluorescent protein and found that...
  9. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...necessary to generate the strictly monomeric EGFP variant, mEGFP (Zacharias et al., 2002). GFP needs oxygen...original jellyfish GFP (AvGFP) to create enhanced GFP (EGFP), a variant with improved brightness (Tsien, 1998... deleted from the C-terminus and about 5 from the N-terminus, but this hardly reduces its size. The substantial... It is standard practice to attach the GFP to the N- or C-terminus of another protein. This may, however... chains. For instance, myristoylation requires an N-terminal consensus sequence (MG-) and prenylation ...disrupted when GFP is fused to these sequences. When N- and C-terminal fusions are not tolerated the alternative...One of the reasons that this works well is that the N- and C-terminus of GFP itself are relatively close...
  10. Sequencing Primers

    Type
    Guide
    ...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...Biosciences) 3' end of DsRed1, forward primer DsRed1-N GTACTGGAACTGGGGGGACAG (BD Biosciences) 5' end of DsRed1...S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding...
  11. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted cytosine methylation...methylation in mammalian cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced...Goodell's lab has deposited pcDNA3.1-dCas9-MQ1(Q147L)-EGFP, a fusion of dCas9 to a small DNA methyltransferase...epigenome-editing tools. pLV hUbC-dCas9-MQ1(Q147L)-EGFP is also available for lentiviral transduction. Lysine-specific...10.1038/onc.2014.470 Taghbalout A, Du M, Jillette N, et al (2019) Enhanced CRISPR-based DNA demethylation...
  12. Plasmids 101: Multicistronic Vectors

    Type
    Blog Post
    ... G D V E E N P G P P2A: (GSG) A T N F S L L K Q A G D V E E N P G P E2A: (GSG) Q C T N Y A L L K L... L A G D V E S N P G P F2A: (GSG) V K Q T L N F D L L K L A G D V E S N P G P * (GSG) residues can...Multicistronic Element Expression Type MSCV-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral...
  13. Quick Guide to Near-Infrared Fluorescent Proteins

    Type
    Blog Post
    ...27 kDa for EGFP) and a possibility to be used as internal tags due to the proximity of the N- and C-termini... normalization to fluorescence of co-transfected EGFP. e Originally reported as a monomer16, IFP2.0 was...1078-1086 (2013). Shcherbakova, D.M., Cox Cammer, N., Huisman, T.M., Verkhusha, V.V. & Hodgson, L. Direct...
  14. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ... can be conveniently performed through the N-terminal eGFP tag carried on all constructs. The Cell-Free...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...making it easy for a researcher to quickly generate N- and C-terminal epitope tag fusions to a protein of...
  15. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ... and sequence overlap (coral mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully... is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2 as the fluorophores; mOrange2 is the ...Brainbow-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two...van Es JH, van den Born M, Kroon-Veenboer C, Barker N, Klein AM, van Rheenen J, Simons BD, Clevers H. Cell...
  16. The Pleiades Promoter Project

    Type
    Collection
    ...Control N/A pEMS1312 cre N/A pEMS1301 cre/EGFP/NLS N/A pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS N/A pEMS1306...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...pEMS1216 EGFP/NLS Ple99 GRP pEMS1371 EGFP/NLS Ple100 GRP pEMS1372 EGFP/NLS Ple101 GRP pEMS1373 EGFP/NLS Ple102...pEMS1171 EGFP/NLS Ple151 OLIG1 pEMS1172 EGFP/NLS Ple152 OXT pEMS1237 EGFP/NLS Ple153 OXT pEMS1238 EGFP/NLS ...
  17. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... can be conveniently performed through the N-terminal eGFP tag carried on all constructs.   pXPG: An...dimerization. Splitting wild-type Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments...2xNLS) and the n-terminal cas9 fragment with FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting.... Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin...destination vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...Split Cas9 system The Cas9 protein is composed of an n-terminal DNA recognition domain and a mostly c-terminal...
  18. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...mCherry Ari Helenius 37533 cfSGFP2-N Extracellular milieu cfSGFP2-N EGFP Ikuo Wada 73208 pcDNA3.1-COXIV-COX8...Gadella 58473 pEGFP-C1 F-tractin-EGFP Actin Filaments F-tractin EGFP Dyche Mullins 41147 pEGFP Centrin2 Centrioles... LC3 EGFP Tamotsu Yoshimori 21073 pEGFP-LC3 Autophagosome LC3 EGFP Tamotsu Yoshimori 24920 pEGFP-LC3 (...Cortactin EGFP Anna Huttenlocher 32907 pEGFP-rNFM Intermediate Filaments (neuronal) Nefm EGFP Anthony Brown...Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP Erich... from GAP43 EGFP Connie Cepko 61099 Lck-GFP Membrane Palmitoylation sequence from Lck EGFP Steven Green...Takemaru 89770 pLenti-EGFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 EGFP Ken-Ichi Takemaru 118084...
  19. Lentivirus Plasmids

    Type
    Collection
    ...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G N/A Envelope VSV-...pCI-VSVG N/A Envelope VSV-G recommended for the FELIX (FIV-based) system Nolan 22502 pCEP4-tat N/A Packaging...-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG N/A Envelope...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...
Showing: 1 - 20 of 46 results