We narrowed to 18 results for: N-EGFP
-
TypeCollection...Control N/A pEMS1312 cre N/A pEMS1301 cre/EGFP/NLS N/A pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS N/A pEMS1306...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...pEMS1216 EGFP/NLS Ple99 GRP pEMS1371 EGFP/NLS Ple100 GRP pEMS1372 EGFP/NLS Ple101 GRP pEMS1373 EGFP/NLS Ple102...pEMS1171 EGFP/NLS Ple151 OLIG1 pEMS1172 EGFP/NLS Ple152 OXT pEMS1237 EGFP/NLS Ple153 OXT pEMS1238 EGFP/NLS ...
-
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...mCherry Ari Helenius 37533 cfSGFP2-N Extracellular milieu cfSGFP2-N EGFP Ikuo Wada 73208 pcDNA3.1-COXIV-COX8...Gadella 58473 pEGFP-C1 F-tractin-EGFP Actin Filaments F-tractin EGFP Dyche Mullins 41147 pEGFP Centrin2 Centrioles... LC3 EGFP Tamotsu Yoshimori 21073 pEGFP-LC3 Autophagosome LC3 EGFP Tamotsu Yoshimori 24920 pEGFP-LC3 (...Cortactin EGFP Anna Huttenlocher 32907 pEGFP-rNFM Intermediate Filaments (neuronal) Nefm EGFP Anthony Brown...Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP Erich... from GAP43 EGFP Connie Cepko 61099 Lck-GFP Membrane Palmitoylation sequence from Lck EGFP Steven Green...Takemaru 89770 pLenti-EGFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 EGFP Ken-Ichi Takemaru 118084... -
Lentivirus Plasmids
TypeCollection...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G N/A Envelope VSV-...pCI-VSVG N/A Envelope VSV-G recommended for the FELIX (FIV-based) system Nolan 22502 pCEP4-tat N/A Packaging...-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG N/A Envelope...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ... -
Cre-lox system
TypeCollection...EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion...sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR Cre, KASH-tagged EGFP, and sgRNA expression hSyn...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer ...pCL20c-MSCV-IRES-CRE Cre MSCV Mammalian Roussel 86805 pLV-EGFP-Cre EGFP-Cre fusion CMV Lentiviral Lasek 87682 AAV-U6gRNA1...15037 also contains IRES-EGFP Mammalian Costantini 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE Cre activates...GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian Green 22799...DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP Switches ... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...blue fluorescent protein 35S-eGFP-nosT - Transient expression vector for eGFP in plants Find FP tagging ...Lentiviral shRNA expression pLJM1-EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin...that adds an N-terminal myristoylation signal GST Protein purification pEBG - N-terminal GST... N-terminal His6-GST-TEV for bacterial expression pDest-565 - N-terminal ...Expresses mCherry tag in mammalian cells pBI-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones...proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression pLV-mCherry...tag pNIC-GST-TEV-GG - Cloning of target gene with N-terminal GST tag and TEV cleavage Transient expression... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...Mammalian U6 yes, cut N. meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1 64116 Mammalian/Lentiviral U6 none N. meningitidis...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1 64118 Mammalian/Lentiviral U6 none N. meningitidis...cut N. meningitidis Joung Cas9 sgRNA vector 68463 Mammalian U6 none S. pyogenes Zhang Cas9/pTREX-n 68708...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... -
Validated gRNA Sequences
TypeCollection...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...26918244 Lu PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana... -
CRISPR Plasmids - Tagging
TypeCollection...provided detailed protocols for N- or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...Doyon's lab deposited a plasmid which introduces an N- or C- terminal affinity tag (3xFLAG-2xSTREP) on endogenous... -
Neurodegeneration Plasmid Collection
TypeCollection...pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1...14121 pcDNA3-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP...Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H)-EGFP VCP His, GFP, HA CMV...Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV...Merrifield 28195 tdp43-EGFP construct2 TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP...Zuoshang Xu 28197 tdp43-EGFP construct4 TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP...Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP... -
Zhang Lab CRISPR Page
TypeCollection... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted... -
Tetracycline Inducible Expression
TypeCollection...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or...Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP...Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS Jason Sheltzer 11651 pLVUT-tTR-KRAB... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...TLCV2 Lentiviral vector for tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf... -
Fluorescent Protein Guide: FRET
TypeCollection...32 amino acid linker mGFP-10-sREACh-N3 Monomeric EGFP attached to super-REACh via a 10 amino acid linker...pPROEX Aqua Cyan Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses ...Mammalian Express a gene of interest fused to the N-terminus of monomeric Cerulean mCerulean C1 Cyan Mammalian...Mammalian Express a gene of interest fused to the N-terminus of Amber Amber C1 Yellow Mammalian Express...Mammalian Express a gene of interest fused to the N-terminus of monomeric Venus mVenus C1 Yellow Mammalian...Mammalian Express a gene of interest fused to the N-terminus of LSSmOrange pLSSmOrange-C1 Orange Mammalian... -
Recombinases AAV Preps
TypeCollection...2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson...none 1, 5, 8, 9, rg* Engel , Nectow 69570 pAAV-EF1a-N-CretrcintG EF1a none 1 Cepko 69571 pAAV-EF1a-C-CreintG... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...mEmerald-pBAD - Bacterial Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP...Citrine, and eGFP pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal...Expression pLV-eGFP - Mammalian Lentiviral Expression Ac5-STABLE1-neo - Insect Expression pCS2+8CeGFP - Zebrafish...urchin pCS2+8NeGFP - Zebrafish/Xenopus/C.elegans/Sea urchin pKT0128 - Yeast Expression EGFP-pBAD - Bacterial...Expression cfSGFP2 493 517 34 5.4 Monomer (A206K) cfSGFP2-N - Mammalian Expression (cysteine-free SGFP2) ZsGreen...5.4 35 min Prone to dimerization pcDNA3-mNeptune2-N - Mammalian Expression mNeptune2 600 650 21 Prone ..., mCerulean Davidson Lab Plasmids - Includes many N- and C-terminal fluorescent proteins Insect Sutherland... -
CRISPR References and Information
TypeCollection...plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for human and...pyogenes Cas9, S. aureus Cas9, S. thermophilus Cas9, N. meningitidis Cas9, or Cas12a from your input sequence...and can work for S. pyogenes , S. thermophilus , or N. meningitidis Cas9 PAMs. Currently supports: mouse... -
Luciferase Plasmid Collection
TypeCollection... with a fluorophore as the acceptor. LumiFluors: EGFP-NanoLuc ( GpNLuc ) and LSSmOrange-NanoLuc ( OgNLuc... 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko...87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning. Lentiviral...UTR Carl Novina 33154 pAC-Luc Firefly Creation of N-terminal Firefly fusions in Drosopholia Michael Rosbash... 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko... John Atkins 174050 pGWB-nLUC Firefly Creation of N-terminal Firefly luciferase fragment for split-luciferase...NanoLuc® CMV Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...pAdx-CMV-iCre-p2A-copGFP 73350 Expresses iCre and EGFP from the CMV promoter pAdx-CMV-iCre-P2A-tdTomato...Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre 72256... -
Trimmer Lab NeuroMab Collection
TypeCollection...IgG2a 182104 Anti-LRRK2/Dardarin, N-terminus [N138/6R] LRRK2/Dardarin, N-terminus Human Mouse IgG2a 182105... 135224 GC52 pEGFPN1 anti-Gephyrin nanobody GC52 Gephyrin Mouse Llama 135225 AC50 pEGFPN1 anti-AMIGO-1...Llama 135226 AC27 pEGFPN1 anti-AMIGO-1 nanobody AC27 AMIGO-1 Mouse Llama 135227 IC65 pEGFPN1 anti-IRSp53 nanobody... nanobody IC65 IRSp53 Mouse Llama 135228 SS80 pEGFPN1 anti-SAPAP2 nanobody SS80 SAPAP2 Mouse Llama 145818...