We narrowed to 1,318 results for: V2
-
Plasmid#138940PurposeEYFP reporter vector for the Logic 37 AND 43 AND 158 2 repeats promoterDepositorInsertLogic 37 AND 43 AND 158 2 repeats
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 43 AND 158 2 repeatsAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD186 Tri-AND Gate, 1 repeat
Plasmid#138939PurposeEYFP reporter vector for the Logic 37 AND 43 AND 158 1 repeat promoterDepositorInsertLogic 37 AND 43 AND 158 1 repeat
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 43 AND 158 1 repeatAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD129 AND Gate, 4 repeats
Plasmid#138938PurposeEYFP reporter vector for the Logic 37 AND 158 NOT 43 4 repeats promoterDepositorInsertLogic 37 AND 158 NOT 43 4 repeats
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 158 NOT 43 4 repeatsAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD127 AND Gate, 2 repeats
Plasmid#138936PurposeEYFP reporter vector for the Logic 37 AND 158 NOT 43 2 repeats promoterDepositorInsertLogic 37 AND 158 NOT 43 2 repeats
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 158 NOT 43 2 repeatsAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD126 AND Gate, 1 repeat
Plasmid#138935PurposeEYFP reporter vector for the Logic 37 AND 158 NOT 43 1 repeat promoterDepositorInsertLogic 37 AND 158 NOT 43 1 repeat
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 158 NOT 43 1 repeatAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD270 ZF43x6-Compact(overlapping ZF37)_EYFP
Plasmid#138934PurposeEYFP reporter vector for the ZF43x6-Compact(overlapping ZF37) promoterDepositorInsertZF43x6-Compact(overlapping ZF37)
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-Compact(overlapping ZF37)Available sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD183 ZF158x6-Compact_EYFP v1
Plasmid#138923PurposeEYFP reporter vector for the ZF158x6-Compact promoterDepositorInsertZF158x6-Compact v1
UseSynthetic BiologyExpressionMammalianPromoterZF158x6-Compact v1Available sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD300 ZF43x15-Compact_EYFP
Plasmid#138910PurposeEYFP reporter vector for the ZF43x15-Compact promoterDepositorInsertZF43x15-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x15-CompactAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD298 ZF43x13-Compact_EYFP
Plasmid#138908PurposeEYFP reporter vector for the ZF43x13-Compact promoterDepositorInsertZF43x13-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x13-CompactAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD295 ZF43x11-Compact_EYFP
Plasmid#138906PurposeEYFP reporter vector for the ZF43x11-Compact promoterDepositorInsertZF43x11-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x11-CompactAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD293 ZF43x9-Compact_EYFP
Plasmid#138904PurposeEYFP reporter vector for the ZF43x9-Compact promoterDepositorInsertZF43x9-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x9-CompactAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD090 ZF92x1_EYFP
Plasmid#138718PurposeEYFP reporter vector for the ZF92x1 promoterDepositorInsertZF92x1
UseSynthetic BiologyExpressionMammalianPromoterZF92x1Available sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD178 ZF158x1_EYFP
Plasmid#138720PurposeEYFP reporter vector for the ZF158x1 promoterDepositorInsertZF158x1
UseSynthetic BiologyExpressionMammalianPromoterZF158x1Available sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD092 ZF97x1_EYFP
Plasmid#138719PurposeEYFP reporter vector for the ZF97x1 promoterDepositorInsertZF97x1
UseSynthetic BiologyExpressionMammalianPromoterZF97x1Available sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD118 ZF37x1_EYFP
Plasmid#138717PurposeEYFP reporter vector for the ZF37x1 promoterDepositorInsertZF37x1
UseSynthetic BiologyExpressionMammalianPromoterZF37x1Available sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Myosin7B-sgRNA
Plasmid#154861PurposeLentiviral expression of Cas9 and sgRNA targeting Myosin7BDepositorAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgMARK3
Plasmid#138706PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorAvailable sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only