We narrowed to 13,284 results for: sequence
-
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6/7deltaE3
Plasmid#175748PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6deltaE3 and pAd5-B7.DepositorInsertAdenovirus 5 genomic region 25043-35938
UseAdenoviral and Synthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT/pT7 LuxR
Plasmid#193625PurposeConstitutive T7 RNAP-mediated expression of LuxR transcription factor for Lux quorum sensing system. LuxR sequence is codon optimized for E. coli.DepositorInsertLuxR
Tags6xHisExpressionBacterialPromoterT7 RNAP promoterAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cdk9-Halo donor
Plasmid#113113PurposeDonor plasmid for knock-in HaloTag fusing to the c-terminal of mouse Cdk9 coding sequenceDepositorInsertCdk9 donor region including homology arms and HaloTag
UseSynthetic BiologyAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
phRL TK 5BoxB sp 36
Plasmid#115365PurposeExpression vector to produce humanized Renilla luciferase with 5BoxB sequences in the 3'UTRDepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianPromoterTKAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL2Basic-EcadK1/EpaIMUT/EboxMUT/Ebox2MUT
Plasmid#19291DepositorInsertE-cadherin
UseLuciferaseExpressionMammalianMutationE-cad promoter sequences from -108 to +125 Ebo…Available SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT/pT7 LasR
Plasmid#193629PurposeConstitutive T7 RNAP-mediated expression of LasR transcription factor for Las quorum sensing system. LasR sequence is codon optimized for E. coli.DepositorInsertLasR
Tags6xHisExpressionBacterialPromoterT7 RNAP promoterAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD_IPF2.0
Plasmid#163124PurposeA plasmid with IFP2.0 coding sequence coded into it. Expresses IFP2.0 with N-term His-tag.DepositorInsertIFP2.0
TagsHisExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B1-deltaE1-MCS
Plasmid#122558PurposeModified block 1, with deletion in E1DepositorInsertAdenovirus 5 genomic region 1-3759
UseSynthetic BiologyMutationAdenovirus sequences 481-3530 replaced with multi…Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS_36x-601_MA1+MA3+MA2
Plasmid#114364Purpose36x Widom 601 nucleosome sequenceDepositorInsert36X601-MA1_3_2
UseUnspecifiedExpressionMammalianAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only