We narrowed to 6,812 results for: KIT;

#178724

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178726

AAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178700

AAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178708

AAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178698

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178699

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#140544

DHC1 tagging with mIAA7

Masato Kanemaki

Yesbolatova et al Nat Commun. 2020 Nov 11;11(1):5701. doi:

Nov. 12, 2020

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#236231

AAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2

Jennifer Lippincott-Schwartz

Benedetti et al Cell. 2025 Jan 23;188(2):484-500.e22. do

May 1, 2025

Academic Institutions and Nonprofits only

#236246

Endogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membrane

Jennifer Lippincott-Schwartz

Benedetti et al Cell. 2025 Jan 23;188(2):484-500.e22. do

May 1, 2025

Academic Institutions and Nonprofits only