We narrowed to 46,057 results for: cha
-
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S285C
Plasmid#98666PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285C and D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S329C
Plasmid#98668PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290V and S329CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R201K_R216K_R254K
Plasmid#104467Purposeexpress MBP hnRNPA2 LC with 4 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBdox-SPI1-T2A-CEBPA-P2A-FLI1_BleoR
Plasmid#250291PurposePiggyBac integration of 3 transcription factors (SPI1, CEBPA, FLI1) under a dox-inducible promoterDepositorInsertSPI1-T2A-CEBPA-P2A-FLI1
ExpressionMammalianAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBdox-MEF2C-T2A-CEBPB-P2A-IRF8_PuroR
Plasmid#250292PurposePiggyBac integration of 3 transcription factors (MEF2C, CEBPB, IRF8) under a dox-inducible promoterDepositorInsertMEF2C-T2A-CEBPB-P2A-IRF8
ExpressionMammalianAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIR-CMV-SCN1A-Variant-1-IRES-mScarlet
Plasmid#162278PurposeEukaryotic expression of human SCN1A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN1A Variant 1, stabilized (SCN1A Human)
TagsIRES-mScarletExpressionMammalianMutationIVS intron inserted after bp2946. Silent codon c…PromoterCMVAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only