We narrowed to 4,185 results for: GCA
-
Plasmid#206841PurposeThe plasmid contains a 312 bp DNA fragment that contained 5 canonical E-boxes (GCCACGTGCA) spaced by 50 nucleotides and cloned into pGL4.23[luc2/minP] (XhoI/HindIII).DepositorInsert5x E-box ((GCCACGTGCA)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorInsertshNRF2v1 (NFE2L2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorInsertSTK11 (STK11 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
UseTagsExpressionMammalianMutationPromoterHuman U6Available sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralTagsExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…PromoterAvailable sinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts2
Plasmid#115854PurposeAGO2 knockdownDepositorInsertAGO2 shRNA (AGO2 Human)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001144754)
Plasmid#75602Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorInsertTRIB2 (TRIB2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorInsertZAP70 (ZAP70 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKIF1C-2xFLAG
Plasmid#130979PurposeExpression of KIF1C-2xFLAG in mammalian cells.DepositorInsertKIF1C-2xFLAG (KIF1C Human)
UseTags2xFLAGExpressionMammalianMutation4 silent mutations that make this construct resis…PromoterCMVAvailable sinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
UseTagsHAExpressionMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available sinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRKCI gRNA (BRDN0001148989)
Plasmid#76401Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCIDepositorInsertPRKCI (PRKCI Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001148301)
Plasmid#77888Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorInsertTRIM24 (TRIM24 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP4K2B gRNA (BRDN0001147019)
Plasmid#77903Purpose3rd generation lentiviral gRNA plasmid targeting human PIP4K2BDepositorInsertPIP4K2B (PIP4K2B Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only