We narrowed to 27,048 results for: STI
-
Plasmid#114071PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a(E174R/S542R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R and S542RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rAPOBEC1-gs-XTEN-gs-hdAsCas12a(D908A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(AsBE1.1) (RTW1351)
Plasmid#114079PurposeCAG promoter expression plasmid for human codon optimized AsBE1.1DepositorInserthuman codon optimized DNase-inactive (D908A) enAsCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (AsBE1.1)
TagsSV40 NLSExpressionMammalianAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1
Plasmid#103860PurposeHeterologous, cobalt-inducible expression of SQE1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertsqualene epoxidase 1 (XF1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted gene is codon optimized. 2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch2#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209069PurposeEntry vector that encodes sgRNAs against mouse Notch2, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch2, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCJ200
Plasmid#162673PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C and a sequence Tyr75:Phe104 to introduce a 6th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C and a sequence Y75-F104 to introduce a 6th…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ210
Plasmid#162683PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C, G489C, S530C, and a sequence Tyr75:Phe104 to introduce a 6th and 7th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C, G489C, S530C, and a sequence Y75-F104 to i…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ220
Plasmid#162686PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224W and C529S mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) with lid deletion and C224W and C529S mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224W, C529S; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ221
Plasmid#162687PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224H and C529F mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with lid deletion and C224H and C529F mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224H, C529F; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RR(S542R/K607R)-NLS(nucleoplasmin)-6xHis (AAS1916)
Plasmid#114076PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RR(S542R/K607R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RR (S542R/K607R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R and K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_MRN1
Plasmid#103858PurposeHeterologous, cobalt-inducible expression of SQE1 and MRN1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertmarneral synthase 1 (MRN1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_CAS1
Plasmid#103856PurposeHeterologous, cobalt-inducible expression of SQE1 and CAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertcycloartenol synthase 1 (CAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
RMCE ABCDE>ala DNA-PKcs
Plasmid#233914PurposeLow copy number provides expression of human DNA-PKcs with the 6 ABCDE phosphorylation sites substituted to alanine.DepositorInserthuman DNA-PKcs ABCDE phosphorylation site mutant (PRKDC Human)
ExpressionMammalianMutationphosphorylation sites 2609, 2612, 2620, 2624, 263…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-henAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nucleoplasmin)-6xHis (AAS1935)
Plasmid#114073PurposeT7 promoter bacterial expression plasmid for human codon optimized enAsCas12a-HF1(E174R/N282A/S542R/K548R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized enAsCas12a-HF1 (E174R/N282A/S542R/K548R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548R and N282AAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-henAsCas12a(E174R/S542R/K548R)-NLS(nucleoplasmin)-6xHis (AAS1885)
Plasmid#114072PurposeT7 promoter bacterial expression plasmid for human codon optimized enAsCas12a(E174R/S542R/K548R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized enAsCas12a (E174R/S542R/K548R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, and K548RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NLS(SV40)x2-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-gs-UGI-NLS(SV40)(enAsBE1.4) (RTW1028)
Plasmid#114084PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.4DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.4)
Tags2x SV40 NLS and SV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NLS(SV40)x2-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(enAsBE1.2)
Plasmid#114082PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.2, also called RTW1348DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.2)
Tags2x SV40 NLS and SV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(enAsBE1.1) (RTW1352)
Plasmid#114081PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.1DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.1)
TagsSV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a-enRVR(E174R/S542R/K548V/N552R)-NLS(nucleoplasmin)-3xHA (AAS1060)
Plasmid#114093PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-enRVR(E174R/S542R/K548V/N552R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a-enRVR (E174R/S542R/K548V/N552R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationE174R, S542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-enRVR(E174R/S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1931)
Plasmid#114075PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-enRVR(E174R/S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-enRVR (E174R/S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-enRR(E174R/S542R/K607R)-NLS(nucleoplasmin)-6xHis (AAS1902)
Plasmid#114077PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-enRR(E174R/S542R/K607R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-enRR (E174R/S542R/K607R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R/S542R/K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-gs-UGI-NLS(SV40)(enAsBE1.3) (RTW1296)
Plasmid#114083PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.3DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.3)
TagsSV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
His-SUMO-Rab10 Q68L
Plasmid#236720PurposeExpresses Rab10 Q68L with His tag and SUMO cleavage sequenceDepositorArticleAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1897)
Plasmid#114074PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RVR (S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNJP
Plasmid#115494PurposeExpression vector for NLS-iRFP-NLS, JNK KTR-mCherry, and mKO-MK2 in mammalian cellsDepositorTagsiRFP, mCherry, and mKOExpressionMammalianMutationmCherry S227F, mCherry G229R, mKO V211GPromoterCAGAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1H_M flap
Plasmid#236718PurposeExpresses PPM1H with PPM1M flap domain sequenceDepositorArticleTagsHAExpressionMammalianMutationPPM1H flap domain replaced with PPM1M flap domainPromoterCMVAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1M_H flap
Plasmid#236719PurposeExpresses PPM1M with PPM1H flap domain sequenceDepositorArticleTagsHAExpressionMammalianMutationPPM1M flap domain replaced with PPM1H flap domainPromoterCMVAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only