We narrowed to 13,201 results for: BASE

#168172

Expression of bPGC in BWMs of C. elegans

Alexander Gottschalk

Woldemariam et al Genetics. 2019 Jul 22. pii: genetics.119

May 10, 2021

Academic Institutions and Nonprofits only

#113687

SaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 20, 2018

Academic Institutions and Nonprofits only

#97320

HMEJ donor for fusing a p2A-mCherry-WPRE reporter to mouse Dbh. AAV backbone.

Hui Yang

Yao et al Cell Res. 2017 May 19. doi: 10.1038/cr.2

July 13, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#125199

SB-transposon plasmid for stable expression of lipid raft-targeted Lyn-AktAR2-EV variant of FRET-based AKT activity reporter

Eric Davis

May 13, 2019

Academic Institutions and Nonprofits only

#245312

Fragmid fragment: (C' terminus) for C>T base editing, 3xHA tag

John Doench, David Root

Oct. 2, 2025

Academic Institutions and Nonprofits only