-
Plasmid#165097PurposeExpresses EcMscLGFP as a fusion protein in E. coli BL21or using in vitro expression.DepositorInsertE. Coli Mechanosensitive Channel of Large Conductance (mscL E. coli)
UseSynthetic BiologyTagsmonomeric Enhanced Green Fluorescent ProteinExpressionBacterialMutationPromoterT7Available sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-HRas G12V
Plasmid#18666DepositorInsertH-Ras (HRAS Human)
UseTagsmonomeric EGFPExpressionMammalianMutationG12V mutation in HRasPromoterAvailable sinceJuly 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-HRas S17N
Plasmid#18665DepositorInsertH-Ras (HRAS Human)
UseTagsmonomeric EGFPExpressionMammalianMutationS17N mutation in H-RasPromoterAvailable sinceJuly 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IB-mGFP-FTH1
Plasmid#192800PurposeStable expression of mGFP-FTH1 in mammalian cellsDepositorInsertFTH1 (FTH1 Human)
UseTagsmonomeric EGFP (A206K)ExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-mEGFP
Plasmid#191847PurposeExpresses the monomeric form of EGFPDepositorInsertmEGFP
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_His-TEV-EGFP
Plasmid#223723PurposeExpression of recombinant protein for purificationDepositorInsertEGFP, not monomeric (has A207)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_shRNA resistant PKA-Cα(E12,14K)-mEGFP
Plasmid#168491PurposeMammalian expression of the E12,14K mutant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric EGFP. Silent mutations were introduced to make it resistant to shRNA knock-down.DepositorInsertthe E12,14K mutant of the mouse PKA catalytic subunit α C-terminally tagged by mEGFP. Resistant to shRNA knock-down.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…TagsExpressionBacterialMutationPromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
EHD2-mEGFP
Plasmid#45932Purposecaveolar protein, confines caveolae to the plasma membraneDepositorInsertEps-15 homology domain-containing protein2 (EHD2 Human)
UseTagsmonomeric EGFP_FrameN1ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-sec:msfGFP
Plasmid#194914PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…TagsExpressionBacterialMutationPromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
sfGFP-Cx43K258stop
Plasmid#69025PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with sfGFP (V206-version) on the N-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
UseTagssuper folder GFPExpressionMammalianMutationnon-monomerized sfGFP fused in frame to N-terminu…PromoterCMVAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 EGFP-3XNLS
Plasmid#58468PurposeExpresses a nuclear-targeted eGFP on a CMV promoterDepositorInsert3X NLS with 3X stop codons
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-mGFP-MutCREB(S133A)
Plasmid#194642PurposeExpresses the fusion of monomeric-EGFP-tagged mutant CREB(S133A) in a Cre-dependent mannerDepositorInsertCREB (Creb1 Rat)
UseAAVTagsmEGFPExpressionMutationS133APromoterAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnCS_mEGFP-DSep2_Peanut-Strep
Plasmid#174496Purposebacterial co-expression of Drosophila Sep2 fused to monomeric EGFP and of Drosophila PeanutDepositorUseTagsStrep and mEGFPExpressionBacterialMutationPromoterAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_altPKA-Cα-mPAGFP
Plasmid#114133PurposeAlternative spliced variant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertTestis only splice variant of mouse PKA catalytic subunit α that has no myristoylation site, C-terminally tagged by mPAGFP (Prkaca Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Lifeact-EGFP-2XNLS
Plasmid#58467PurposeExpresses a nuclear-targeted actin filament reporter, consisting of the peptide Lifeact, on a CMV promoterDepositorInsertsLifeact
2X NLS with 2X stop codons
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Utr230-EGFP-3XNLS
Plasmid#58466PurposeExpresses a nuclear-targeted actin filament reporter, consisting of the first 230 amino acids of human utrophin, on a CMV promoterDepositorInsertsUseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-EGFP
Plasmid#105793PurposeExpression of your protein of interest in fusion with green fluorescent protein at the C-terminus (cleavable by TEV), (PMID: 8885998, 8805248). EGFP is not truly monomeric (PMID: 11988576, 22869113)DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-EGFPExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-EGFP-TEV
Plasmid#105776PurposeExpression of your protein of interest in fusion with green fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 8885998, 8805248). EGFP is not truly monomeric (PMID: 11988576, 22869113)DepositorTypeEmpty backboneUseFlp-in competentTagsEGFP-TEVExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only