We narrowed to 10,528 results for: yeast
-
Plasmid#154369PurposeYeast expression of Ost4DepositorInsertOst4 (ost4 Fission Yeast)
ExpressionYeastAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
3021_pETcon-SARS-CoV-2-RBD_K417N_E484K_N501Y
Plasmid#184406Purposeyeast surface display of the SARS-CoV-2 Beta variant RBDDepositorInsertSARS-CoV-2 Beta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationK417N+E484K+N501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
3159_pETcon-SARS-CoV-2-RBD-L452R-T478K
Plasmid#184407Purposeyeast surface display of the SARS-CoV-2 Delta variant RBDDepositorInsertSARS-CoV-2 Delta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationL452R+T478KAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDUAL-P41nmt1-Nup124-GFP-MTn
Plasmid#154365PurposeYeast expression of Nup124DepositorAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pACT-HAB1
Plasmid#241276PurposeYeast two hybrid vector expressing AD-HAB1DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30-LaccID
Plasmid#234652PurposeExpresses LaccID evolved variant in yeastDepositorInsertLaccID
TagsHRV 3C protease site-GSG linker-8xHis tagExpressionYeastMutationV11A, Q45R, N74S, R121S, I126V, D255G, L300VPromoterGal1pAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only