We narrowed to 10,528 results for: yeast
-
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR
Plasmid#203165PurposeYeast expression vector for hNUS1DepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR R290H
Plasmid#203167PurposeYeast expression vector for hNUS1 R290HDepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free ClLIS1 (M)
Plasmid#182484PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and limonene synthase from Citrus limon (ClLIS1; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
LS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
3020_pETcon-SARS-CoV-2-RBD_N501Y
Plasmid#184405Purposeyeast surface display of the SARS-CoV-2 Alpha variant RBDDepositorInsertSARS-CoV-2 Alpha Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationN501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-IpgD(C439S)
Plasmid#183673PurposeInducible Shigella flexneri IpgD (catalytically inactive) for expression in yeastDepositorInsertIpgD
ExpressionYeastMutationC439SPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LANS1-Set2
Plasmid#122002PurposeFLAG-LANS-Set2: FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInserthistone methyltransferase SET2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsFLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only