We narrowed to 16,014 results for: grna
-
-
-
-
-
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: TACGTTCTCTATCACTGATAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSEVA451-Cpf1
Plasmid#192362PurposeCRISPR-based vector for genome editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas12a, gRNA scaffold
UseCRISPRAvailable sinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSgRNA
UseCRISPRAvailable sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-Tmem2 gRNA
Plasmid#246569PurposeCRISPR vector co-expressing Cas9 and a mouse Tmem2 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd7 gRNA
Plasmid#246566PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd7 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd4 gRNA
Plasmid#246563PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd4 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd8 gRNA
Plasmid#246565PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd8 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd6 gRNA
Plasmid#246553PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd6 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd9 gRNA
Plasmid#246551PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd9 gRNADepositorAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL560
Plasmid#231161PurposeT-DNA encoding TRV2 with ipt and mobile gRNA targeting SlPDSDepositorInsertipt and mobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only
