We narrowed to 13,079 results for: BASE

#113694

U6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Jan. 2, 2019

Academic Institutions and Nonprofits only

#190878

Cre-on expression of soma-targeted QuasAr6a under an neuronal promoter

Adam Cohen

Tian et al Nat Methods. 2023 Jul;20(7):1082-1094. d

Nov. 17, 2022

Academic Institutions and Nonprofits only

#145030

piggyBac vector for expressing a Turquoise calcium sensor (GECI) that reports with lifetime and intensity changes

Dorus Gadella

van der Linden et al Nat Commun. 2021 Dec 9;12(1):7159. doi:

June 23, 2021

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#195739

Express APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coli

Seung-Goo Lee

Jeong et al Chem Eng J, 2023

March 3, 2023

Academic Institutions and Nonprofits only

#132587

gRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )

James Thomson

Zhang et al Stem Cell Reports. 2019 Jun 11;12(6):126

Oct. 8, 2019

Academic Institutions and Nonprofits only

#84352

Expression of the human Huntingtin Exon1 protein containing 43Q in E.coli

Hilal Lashuel

Vieweg et al J Biol Chem. 2016 Jun 3;291(23):12074-86

Dec. 19, 2017

Academic Institutions and Nonprofits only

#176526

Expression vector with a BamHI site in-frame with a Gly-Ser linker fused to EGFP; serves as the backbone for PAR binding domain incorporation for LivePAR

Robert Sobol

Koczor et al Cell Rep. 2021 Nov 2;37(5):109917. doi:

Jan. 27, 2022

Academic Institutions and Nonprofits only

#228986

For bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.

Michael Rout

Fridy et al J Biol Chem. 2024 Aug 2;300(9):107623. d

Jan. 14, 2025

Academic Institutions and Nonprofits only

#228996

For bacterial expression of anti-rabbit IgG nanobody LaRIgG-2, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.

Michael Rout

Fridy et al J Biol Chem. 2024 Aug 2;300(9):107623. d

Jan. 13, 2025

Academic Institutions and Nonprofits only