-
Plasmid#54323PurposeTALEN expression construct for targeting the murine ROSA26 locus. It recognize the sequence: CTGCAACTCCAGTCT. Can be used with the pBS SK mCherryROSAbsr plasmidDepositorInsertTALEN for the murine ROSA26 locus
UseMouse Targeting and TALENTagsExpressionMammalianMutationPromoterCAGGAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-ROSAr
Plasmid#54324PurposeTALEN expression construct for targeting the murine ROSA26 locus. It recognize the sequence: GGGAGTCTTCTGGGC. Can be used with the pBS SK mCherryROSAbsr plasmidDepositorInsertTALEN for the murine ROSA26 locus
UseMouse Targeting and TALENTagsExpressionMammalianMutationPromoterCAGGAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOpen-DNA Topoisomerase 1B Vaccinia Virus
Plasmid#165510PurposeUsed in TOPO cloning. Recognizes the DNA sequence 5'-(C/T)CCTT-3' and digests double stranded DNA at this sequence.DepositorInsertDNA Topoisomerase 1B Vaccinia Virus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
-
pMS2-1
Plasmid#220627PurposePlasmid used to place the RNA sequence of interest next to two MS2 coat protein recognition sites.DepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZE-P9-egfp
Plasmid#201790Purposethe promoter can be recognized by PadRDepositorInsertP9
UseTagsExpressionBacterialMutationWTPromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS2-2
Plasmid#220628PurposePlasmid allows you to place the RNA sequence of interest next to two MS2 coat protein recognition sites.DepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
p_SNIPR_target_WT
Plasmid#139465PurposeT7 RNAP-driven expression of the cognate SNIPR trigger RNA that is complementary to the SNIPR RNA sensorDepositorInsertTarget_WT
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
p_SNIPR_target_mut_36
Plasmid#139466PurposeT7 RNAP-driven expression of a non-cognate SNIPR trigger RNA with a mutation at position 36DepositorInsertTarget_mut36
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHH03C_32
Plasmid#120897PurposeFunctional test of ECF sigma factors and their cognate promotersDepositorInsertECF32_1122
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
p_SNIPR_target_GUmut33AtoG
Plasmid#139468PurposeT7 RNAP-driven expression of a non-cognate SNIPR trigger RNA with a mutation at position 33DepositorInsertTarget_mutGU33
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-(empty)-TAG
Plasmid#138209PurposeTo facilitate restriction cloning of an RNA of interest with a TGT recognition element in the 3' regionDepositorTypeEmpty backboneUseT7 transcriptionTagsTAG sequenceExpressionMammalianMutationPromoterCMV Promoter, T7 PromoterAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNR188
Plasmid#79543PurposeOutput plasmid: contains 16-state register made up of TP901, BxbI, and A118 recognition sites.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-HIS-TagGFP2-TEV-GGG-ELP(120nm)-Cys
Plasmid#90473PurposeElastin Like Polypeptide: [(VPGEG)-(VPGVG)4-(VPGAG)2-(VPGGG)2-(VPGEG)]6, with N-Term TagGFP2, and a TEV-cleavage site, leaving an N-terminal Sortase Recognition Sequence GGG and a C-terminal CysteineDepositorInsertTagGFP2-TEV-GGG-ELP(120nm)-Cys
UseTagsCysteine and Sortase-TagExpressionBacterialMutationPromoterT7Available sinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCHAP4
Plasmid#206850PurposeA plasmid containing a 16,121 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNR160
Plasmid#79542PurposeOutput plasmid: contains 5-state register made up of TP901 and BxbI recognition sites.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-HIS-TagGFP2-TEV-GGG-ELP(40nm)-Cys
Plasmid#90474PurposeElastin Like Polypeptide: [(VPGEG)-(VPGVG)4-(VPGAG)2-(VPGGG)2-(VPGEG)]2, with N-Terminal TagGFP2 and TEV-cleavage site, leaving an N-terminal Sortase Recognition Sequence GGG and a C-terminal CysteineDepositorInsertTagGFP2-TEV-GGG-ELP(40nm)-Cys
UseTagsCysteine and Sortase-TagExpressionBacterialMutationPromoterT7Available sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable sinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDual_dsCas9_Puro_hs_NC_chr1
Plasmid#214688PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralTagsExpressionMutationPuromycin resistance cassette has silent mutation…PromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only