We narrowed to 6,098 results for: tTA
-
Plasmid#177928PurposeExpresses yeGFP under control of doxycycline-responsive TET4 promoter (contains four rtTA binding sites)DepositorArticleInsertEGFP
ExpressionBacterial and YeastPromoterTET4 (contains four rtTA binding sites)Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Rhesus AAVS1-CAG-copGFP
Plasmid#84209PurposeRhesus AAVS1 safe harbor gene targeting donor expressing CAG-driven copGFPDepositorInsertsRhesus AAVS1 5’ homology arm
Rhesus AAVS1 3’ homology arm
ExpressionMammalianAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG1guide_RUBY_EggCas9
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRExpressionPlantPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_NC_chr1
Plasmid#214690PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2B-57
Plasmid#177927PurposeExpresses yeGFP under control of doxycycline-responsive TET3 promoter (contains three rtTA binding sites)DepositorArticleInsertEGFP
ExpressionBacterial and YeastPromoterTET3 (contains three rtTA binding sites)Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDDRFP-A1B1
Plasmid#36291DepositorInsertDimerization dependent RFP-A1B1
TagsHisExpressionBacterialAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shFEN3
Plasmid#17922DepositorInsertshFEN3
UseLentiviral and RNAiExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr1
Plasmid#214682PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_NC_chr1
Plasmid#214686PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSSa26
Plasmid#186784PurposeExpression of reverse transactivator (CgrtTA)DepositorInsertCgrtTA
ExpressionYeastPromoterScPGK1pAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-Max-N1
Plasmid#21718DepositorInsertDsRed-Max
ExpressionMammalianAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pNK055b
Plasmid#156371PurposeExpresses mCherryDepositorInsertmCherry
UseSynthetic BiologyAvailable SinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDDRFP-A1B1-DEVD
Plasmid#36294DepositorInsertddRFPA1B1-DEVD
ExpressionMammalianAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
KG#865
Plasmid#110912PurposeCoding sequence for attaching the Auxin Inducible Degron to the C-terminus of a protein followed by a 5X Myc tag with spacersDepositorInsertAuxin Inducible Degron-5X Myc-Spacers for C-terminal attachment
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#883
Plasmid#110913PurposeCoding sequence for attaching the a 5X Myc tag with spacers followed by the Auxin Inducible Degron to the N-terminus of a proteinDepositorInsert5X Myc-Spacers-Auxin Inducible Degron for N-terminal attachment
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF416.1.0-gDNA
Plasmid#112468PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF416DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQE30-His-LZ3B-T7RNAP
Plasmid#247367PurposeExpress LZ3B-T7RNAP that dimerize with LZ3ADepositorInsertLZ3B-T7 RNAP
TagsHisExpressionBacterialPromoterT5-lacOAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only