We narrowed to 24,046 results for: Sis

#112813

gateway cloning destination vector for expressing enhancer driven CD4-tdTomato

Chun Han

Poe et al Genetics. 2018 Nov 30. pii: genetics.118

June 28, 2019

Academic Institutions and Nonprofits only

#207103

pX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 24, 2024

Academic Institutions and Nonprofits only

#157877

mCherry is expressed under the mycobacterial phsp60 heat shock promoter for in vivo and in vitro detection.

Jeffrey Cirillo

Kong et al PLoS One. 2016 Mar 2;11(3):e0149972. doi

Sept. 30, 2020

Academic Institutions and Nonprofits only

#194539

High copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeon

Patrick Gibney

Smith et al Appl Microbiol. 2024; 4(1):453-469. doi:

Oct. 31, 2024

Academic Institutions and Nonprofits only

#201090

Trypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene tagging

Samuel Dean

Paterou et al Open Biol. 2025 Apr;15(4):240361. doi: 1

July 10, 2023

Academic Institutions and Nonprofits only

#201096

Trypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene tagging

Samuel Dean

Paterou et al Open Biol. 2025 Apr;15(4):240361. doi: 1

July 29, 2024

Academic Institutions and Nonprofits only

#135210

Red fluorescent tag

David Tobin

Walton et al PLoS One. 2015 Oct 7;10(10):e0138949. do

Dec. 19, 2019

Academic Institutions and Nonprofits only

#106134

EasyCloneYALI system-based yeast integrative vector carrying loxP-flanked hygromycin-resistance marker, integration into Yarrowia lipolytica chromosomal location IntE_3, USER site for cloning, amp resistance

Irina Borodina

Holkenbrink et al Biotechnol J. 2018 Jan 29. doi: 10.1002/

April 6, 2018

Academic Institutions and Nonprofits only

#160014

Integrative vector for K. marxianus, targeting the LAC4 locus. Hygromycin selection.

John Morrissey

Rajkumar et al Microb Cell Fact. 2020 Nov 11;19(1):207.

Nov. 20, 2020

Academic Institutions and Nonprofits only