We narrowed to 11,225 results for: 158
-
Plasmid#12761PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf73
ExpressionMammalianAvailable SinceDec. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMT468
Plasmid#139394PurposeNanoluc placed on Output 2 of the 2in3out circuit (A001 and P002 design) with aTC and Bile Acid as inputs, AmpR, ErmRDepositorInsertNanoluc placed on Output 2 of the 2in3out circuit (A001 and P002 design) with aTC and Bile Acid as inputs
UseSynthetic BiologyPromoteraTC and BA inducible promotersAvailabilityAcademic Institutions and Nonprofits only -
pET-17b_K490clm_E215C
Plasmid#169995PurposeKinesin KIF5B K490 cysteine light mutant with E215C mutation for single cysteine labelingDepositorInsertkinesin family member 5B, isoform CRA_a
Tags6xHISExpressionBacterialMutationC7S, C65A, C168A, C174S, E215C, C294A, C330S, C42…PromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pHR-H2B-mGFP
Plasmid#173892Purposefor H2B labelingDepositorAvailabilityAcademic Institutions and Nonprofits only -
PEmax_2star_pet21A
Plasmid#227675PurposeExpression plasmid for PEMAX** protein in bacteria.DepositorInsertPEmax_2_star
UseCRISPRTagsHis-tagExpressionBacterialPromoterT7Available SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCART0002_pIVTRup(BsmBI)_CBE4max-SpRY
Plasmid#242540PurposeIVTDepositorInsertCBE4max-SpRY (SpRY-CBE)
UseCRISPRMutationD10AAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT-HAB1_star
Plasmid#241277PurposeOrthogonal PYR1/HAB1 sensor moduleDepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-hGSDME
Plasmid#218939PurposeExpression of N-terminal FLAG tagged human gasdermin EDepositorAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA ADAR2
Plasmid#237856PurposeLentiviral expression of ADAR2DepositorInsertADAR2 (ADARB1 Human)
ExpressionMammalianAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only