We narrowed to 7,592 results for: ski
-
Plasmid#203270PurposeOverexpress HLA alleleDepositorInsertA*74:01:01 (HLA-A Human)
ExpressionMammalianAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
B*40:02:01
Plasmid#203239PurposeOverexpress HLA alleleDepositorInsertB*40:02:01 (HLA-B Human)
ExpressionMammalianAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
B*55:02:01
Plasmid#203240PurposeOverexpress HLA alleleDepositorInsertB*55:02:01 (HLA-B Human)
ExpressionMammalianAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPI-UPP2-3xFLAG
Plasmid#201645PurposeOver-expression of 3xFLAG-tagged human UPP2DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-RPE_sgRNA1
Plasmid#201618PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertRPE (RPE Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TYMS_sgRNA2
Plasmid#201629PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTYMS (TYMS Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK1_sgRNA1
Plasmid#201630PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK1 (UCK1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK1_sgRNA2
Plasmid#201631PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK1 (UCK1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK2_sgRNA1
Plasmid#201632PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK2 (UCK2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-KIF1aMotor-mScarlet-FKBP
Plasmid#191336PurposeExpresses the fluorescently labeled plus-end directed KIF1a motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-mScarlet-KIFC1motorN593K
Plasmid#191335PurposeExpresses the fluorescently labeled minus-end directed KIFC1 motor-deficient motor domain fused to FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-mScarlet-KIFC1N593K (KIFC1 Human)
ExpressionMammalianMutationmotor domain aa 125-673; N593KAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_591
Plasmid#160653PurposeExpresses OLE1 under the control of the yeast Sup35 promoterDepositorAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-STAT2
Plasmid#183931PurposeOptogenetic PHR domain coupled to GFP and STAT2 activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-Rta
Plasmid#183930PurposeOptogenetic PHR domain coupled to GFP and Rta activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-VPR
Plasmid#183928PurposeOptogenetic PHR domain coupled to GFP and VPR activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-FUSN
Plasmid#183932PurposeOptogenetic PHR domain coupled to GFP and FUSN domain with a high phase separation propensity; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P RTEL1_1
Plasmid#160799PurposeSuppress RTEL1DepositorInsertshRTEL1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B CDC25A_2
Plasmid#160768PurposeSuppress CDC25ADepositorInsertshCDC25A_2
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only