We narrowed to 8,455 results for: gal
-
Plasmid#221399PurposeMammalian expression of human integrin beta1 Q280* K418* ectodomainDepositorInsertintegrin beta1 Q280* K418* ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK845
Plasmid#219746PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Pichia pastoris, Homo sapiensDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* N562* ectodomain
Plasmid#221400PurposeMammalian expression of human integrin beta1 N391* N562* ectodomainDepositorInsertintegrin beta1 N391* N562* ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344A-mKate2-splitmVenusN
Plasmid#69584PurposeExpresses mutated p53-L344A tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426-Cup1p-FUS-FusionRed
Plasmid#188393PurposeCu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cellsDepositorAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only