We narrowed to 8,642 results for: GAL
-
Plasmid#69585PurposeExpresses mutated p53-L344A tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426-Cup1p-FUS-FusionRed
Plasmid#188393PurposeCu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cellsDepositorAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GCET2_p.H177Q
Plasmid#81320PurposeGateway Donor vector containing GCET2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001147665)
Plasmid#77909Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001145991)
Plasmid#77910Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only