-
Plasmid#118217PurposeBacterial expression plasmid encoding X. laevis H2B residues 1-114(K114A) as a chimeric fusion to GyrA intein with chitin binding domain at the C-terminus. H2B fragment can be derivatized using MESNa.DepositorInsertxlH2B(1-114)
UseTagsMxe-GyrA intein fused to chitin binding domainExpressionBacterialMutationLysine 114 to alaninePromoterT7Available sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-rap1-K462-463-651R
Plasmid#84564PurposeThis plasmid can be used as a donor for subcloning into Gateway destination vectors.DepositorInsertRAP1 (RAP1 Budding Yeast)
UseGateway donor plasmidTagsExpressionMutationK462-463-651RPromoternoneAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-rap1-K43-117-118R
Plasmid#84565PurposeThis plasmid can be used as a donor for subcloning into Gateway destination vectors.DepositorInsertRAP1 (RAP1 Budding Yeast)
UseGateway donor plasmidTagsExpressionMutationK43-117-118RPromoternoneAvailable sinceOct. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFNC-5
Plasmid#233297PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. TcR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
UseTagsExpressionBacterialMutationPromoterPEM7 and unknownAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-3
Plasmid#233296PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. CmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
UseTagsExpressionBacterialMutationPromoterPEM7 and unknownAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
UseTagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…PromoterAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-6
Plasmid#227669PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. GmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
UseTagsExpressionBacterialMutationPromoterPEM7Available sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
UseTagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…PromoterAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantMutationPromoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP734_L2pV1_1I_OCS-rLUC_F-NOS-FlpO
Plasmid#192377PurposeTo test if the NOS promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP735_L2pV1_1I_OCS-rLUC_F-TCTP-FlpO
Plasmid#192378PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
H2B-mNeonGreen_FRB(DmrC)_IRESpuro2
Plasmid#182918PurposeExpesses H2B-mNeonGreen_FRB(DmrC). Can be used to target FKBP(DmrA) tagged proteins to H2BDepositorInsertpH2B (H2BC16P Human)
UseTagsmNeonGreen-FRB(DmrC)ExpressionBacterial and MammalianMutationPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker-3xFLAG KI
Plasmid#182679PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.DepositorInsertNefl-targeting gRNA and linker-3xFLAG donor sequence (Nefl Mouse)
UseTagsExpressionMammalianMutationPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP*
Plasmid#175238PurposeBacterial expression and purification, low affinity SUMOylation substrate that can recruited to FRB with rapamycin, point mutation F562A reduces affinity for E2, increasing the KmDepositorInsertRANGAP1 (RANGAP1 Human)
UseTagsExpressionBacterialMutationAmino acid 562 F to APromotertacAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj13
Plasmid#173143PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj13 (kcnj13 Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj1b
Plasmid#173126PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj1b (kcnj1b Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj8
Plasmid#173134PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertUsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-MCS-LexA-VP16-MiniWhite
Plasmid#165900PurposeBlasticidin resistant LexA driver vector with Mini-white CDS eye marker. Contains an enhancer grammar GB20 entry point for custom enhancers. Standard cut-and-paste cloning can also be used. Vector uses Purple-White bacteria colony screening for identification of correct cloningDepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only