We narrowed to 8,067 results for: 104
-
Plasmid#1308DepositorInsertHsp104 L892W (HSP104 Budding Yeast)
Tags10X His tagExpressionBacterialMutationChanged Leu 892 to TrpAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJC45BS104 F130W
Plasmid#1302DepositorInsertHsp104 F130W (HSP104 Budding Yeast)
Tags10X His tagExpressionBacterialMutationChanged Phe 130 to TrpAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJC45BS104 L553W
Plasmid#1306DepositorInsertHsp104 L553W (HSP104 Budding Yeast)
Tags10X His tagExpressionBacterialMutationChanged Leu 553 to TrpAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTet_KaeCanABC(G104K)
Plasmid#248956PurposeCanABC from K. aerogenes under control of pTet and the native promoter, with CanC mutated (G104K)DepositorInsertKaeCanABC(G104K)
ExpressionBacterialMutationG104KAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Gfa104-hIRβ
Plasmid#236227PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) in astrocyteDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK104 [Term_tetA_PartType7]
Plasmid#229341PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Term_tetA_PartType7DepositorInserttetA Terminator
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only