We narrowed to 697 results for: plko 1
-
Plasmid#209103PurposeGFP expressing shRNA targeting Cdh11DepositorInsertshCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh2.1 GFP
Plasmid#209099PurposeGFP expressing shRNA targeting Cdh2DepositorInsertshCdh2.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh11.1 GFP
Plasmid#209104PurposeGFP expressing scramble of shRNA targeting Cdh11DepositorInsertscrCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.2-GFP
Plasmid#209098PurposeGFP expressing scramble of shRNA targeting Ctnnd2 3' UTRDepositorInsertscrCtnnd2.2
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh20.1 GFP
Plasmid#209105PurposeGFP expressing shRNA targeting Cdh20DepositorInsertshCdh20.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh10.1 GFP
Plasmid#209101PurposeGFP expressing shRNA targeting Cdh10DepositorInsertshCdh10.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.2-GFP
Plasmid#209097PurposeGFP expressing shRNA targeting Ctnnd2 3' UTRDepositorInsertshCtnnd2.2
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.1-GFP
Plasmid#209096PurposeGFP expressing scramble of shRNA targeting Ctnnd2 N terminusDepositorInsertscrCtnnd2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Cd155 shRNA2
Plasmid#166488PurposeMouse Cd155 RNAiDepositorInsertshRNA for mouse Cd155 (Pvr Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Cd155 shRNA1
Plasmid#166487PurposeMouse Cd155 RNAiDepositorInsertshRNA for mouse Cd155 (Pvr Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shRPS6
Plasmid#125780Purposeconstitutive expression of a short-hairpin RNA targeting human RPS6 (RNAi positive control)DepositorInsertshRPS6 (RPS6 Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No1
Plasmid#70058PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #1DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No3
Plasmid#70060PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #3DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No4
Plasmid#70065PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #4DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No5
Plasmid#70066PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #5DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No6
Plasmid#70067PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #6DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No8
Plasmid#70069PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #8DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast-cfRab8b_1
Plasmid#26708DepositorInsertdog Rab8b RNAi
UseLentiviral and RNAiExpressionMammalianMutationDog Rab8b RNAiAvailable SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only