We narrowed to 10,496 results for: nar
-
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCML 961
Plasmid#98848PurposepTriFC_aidB. Expresses protein-NYFP and 2MS2BD-5' UTR mStrawberry fusions in E. coli for Dual-fluorescence TriFC assay (ampR).DepositorInserts5' UTR + first 100 nucleotides of coding sequence of the aidB gene
csrA
UseTagsExpressionBacterialMutationPromoterpLacOAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha1-390
Plasmid#62521PurposeC-terminal aa391-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 391-1374 deleted (DROSHA Human)
UseTagsGFPExpressionMammalianMutationdeleted amino acids 391-1374PromoterAvailable sinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Flag-PolB(K244A/T304I)-Puro
Plasmid#177144PurposeLentiviral vector expressing Flag-PolB(K244A/T304I) and a puromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega2_Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1678)
Plasmid#160642PurposeModule for the dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertGRLacIBDGal4AD / RDF
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha1-850
Plasmid#62522PurposeC-terminal aa851-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 851-1374 deleted (DROSHA Human)
UseTagsGFPExpressionMammalianMutationdeleted amino acids 851-1374PromoterAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtTAS1c-D2-B/c
Plasmid#137883PurposeGateway-compatible entry vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor at position downstream 3'D1[+]DepositorInsertAtTAS1c-D2-B/c
UseGateway-compatible entry cloneTagsExpressionMutationA. thaliana TAS1c precursor sequence including a …PromoterAvailable sinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-21a_2xNLS_FnCpf1_MBP_protein_expression
Plasmid#120801PurposeProtein expression plasmid for 2xNLS FnCpf1 in pET-21a backboneDepositorInsert2xNLS_FnCpf1
UseCRISPRTagsMBP and NLSExpressionBacterialMutationPromoterT7Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(214-598)
Plasmid#135440PurposeExpresses SFPQ 214-598 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
UseTagsHexahistidineExpressionBacterialMutationPromoterT7Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE3987
Plasmid#137716PurposeExpresses dLbCas12a-RVRR-BE in mammalian cells.DepositorInsertdLbCas12a-RVRR-BE
UseTags6xHis, APOBEC-1, SV40 NLS, and UGIExpressionMammalianMutationG532A, K538V, Y542R, K595RPromoterCMVAvailable sinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(276-535)
Plasmid#135436PurposeExpresses SFPQ 276-535 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
UseTagsHexahistidineExpressionBacterialMutationPromoterT7Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
FnoCas12a-DR-cr in PBCSK-
Plasmid#126642PurposeCloning vector FnoCas12a DR-crRNA for expression in mammalian cellsDepositorInsertFnoCas12a Full Length Direct Repeat crRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6 PromoterAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQCXIpuro-H3.3K4M-FLAG/HA
Plasmid#128742PurposeExpression of histone H3.3K4M-FLAG/HADepositorInsertH3.3K4M (H3-3A Human)
UseRetroviralTagsFLAG and HAExpressionMutationK4MPromoterCMVAvailable sinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot1_J
Plasmid#146709PurposeInsect Expression of DmNot1DepositorInsertDmNot1 (Not1 Fly)
UseTagsExpressionInsectMutationThree non silent mutations N605S, K759M, G1999S a…PromoterAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
KZ501: pMVP (L3-L2) P2A-Puro + polyA
Plasmid#121780PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Puro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRY-tTA (B702)
Plasmid#92032PurposeExpresses CRY2 (Full length, mutated NLS) fusion with tTA2 'tet-OFF' transcriptional activatorDepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagstTA2 (TetR fused to VP64)ExpressionMammalianMutationNLS on CRY2 is mutatedPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG802: pMVP (L3-L2) V5 epitope tag + polyA
Plasmid#121755PurposepMVP L3-L2 entry plasmid, contains V5 epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertV5 epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA001: pMVP (L3-L2) P2A-mCherry + WPRE
Plasmid#121774PurposepMVP L3-L2 entry plasmid, contains mCherry-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term mCherry linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-mCherry + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only