We narrowed to 31,863 results for: ica
-
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer P-null replicon
Plasmid#65462Purposecontaining 1.3 units of the P-null HBV genome (subtype ayw)DepositorInsert1.3 units of the P-null HBV genome
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCap-SG5-Hgy
Plasmid#227580PurposeCapture plasmid with hygromycin resistance and pSG5 repliconDepositorTypeEmpty backboneAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMito.iGABASnFR.F102Y.Y137L
Plasmid#112177PurposeGABA SensorDepositorInsertiGABASnFR.F102Y.Y137L
ExpressionMammalianMutationF102Y.Y137LAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD143
Plasmid#119880PurposeArabinose inducible dCas9sth1 and constitutive sgRNA on pAL5000/pMB1 backbone with gentamicin resistance.DepositorInsertpBAD_dCas9sth1
ExpressionBacterialAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAWP78-PVCpnf_pvc13-Ad5RGDPK7
Plasmid#198291PurposeProduces PVCs retargeted with expanded tropism hAd5 knob (RGD and PK7 insertions)DepositorInsertPVCpnf_pvc13-Ad5RGDPK7
ExpressionBacterialAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRPromoter2x35SAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRExpressionMammalianAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC57-gCarvi-T2A
Plasmid#190333PurposeFluorescent reporter for cAMPDepositorInsertgCarvi
UseUnspecifiedAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHelp
Plasmid#227583PurposeAccessory plasmid with a sgRNA cassette for Cas9, and ampicillin resistanceDepositorInsertguide RNA scaffold
UseCloning vectorAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only