We narrowed to 5,965 results for: crispr cas9 expression plasmids
-
Plasmid#163791PurposeThe plasmid expresses human codon-optimized BlatCas9, gRNA expression elements and blasticidin resistence gene.DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-ABE-P48R
Plasmid#161816PurposeExpresses ABE-P48R in mammalian cellsDepositorInsertbpNLS-TadA7.10(P48R)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
UseCRISPRTagsExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorInsertWhi5-sg106 (WHI5 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
cr3Vn
Plasmid#184861Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and an V. natriegens-specific recombination systemDepositorInsertCas9, gam, bet, exo
UseTagsCas9 ssrA degradation tagExpressionBacterialMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
cr3Ec
Plasmid#184860Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and an E.coli-specific recombination systemDepositorInsertCas9, gam, bet, exo
UseTagsCas9 ssrA degradation tagExpressionBacterialMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
cr3Dd
Plasmid#184862Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and a species-specific recombination systemDepositorInsertCas9, bet, exo
UseTagsCas9 ssrA degradation tagExpressionBacterialMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-sgRNA(MS2)
Plasmid#102560PurposePiggybac transposon sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonTagsExpressionMammalianMutationPromoterU6Available sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
SGL40C.EFS.dTomato
Plasmid#89395PurposeAdvanced lentiviral Vector for sgRNA (hU6 Promoter) delivery with dTomato expression (EFS Promoter)DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFH6_new
Plasmid#105866Purposemore efficient version of pFH6; Subcloning of any sgRNA via BbsI siteDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR and Synthetic Biology; SubcloningTagsExpressionPlantMutationPromoterAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only