We narrowed to 23,973 results for: Sis

#79008

Bacterial expression - MBP-his tagged LbCpf1 (E.coli codon optimized)

Jin-Soo Kim

Kim et al Nat Biotechnol. 2016 Jun 6. doi: 10.1038

July 1, 2016

Academic Institutions and Nonprofits only

#126072

For CRISPR/Cas9 delivery in maize. Expresses Cas9 with rice ubiquitin promoter, BAR with 35S promoter, and sgRNA/PTG with rice snoRNA U3 promoter (pol III). Can produce 1 or more gRNAs.

Charles Hunter

Hunter et al Plants (Basel). 2021 Apr 8;10(4). pii: p

June 24, 2019

Academic Institutions and Nonprofits only

#90336

ATF6 - Unfolded protein response element (UPRE) gene reporter

Ramnik Xavier

O'Connell et al Cell Syst. 2016 May 25;2(5):323-34. doi:

Nov. 5, 2025

Academic Institutions and Nonprofits only

#20863

Jie-Oh Lee

Park et al Nature. 2009 Apr 30;458(7242):1191-5. do

May 20, 2009

Academic Institutions and Nonprofits only

#207093

pX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 30, 2025

Academic Institutions and Nonprofits only

#8592

Lewis Cantley

Shaw et al Proc Natl Acad Sci U S A 2004 Mar 9;101(

July 18, 2005

Academic Institutions and Nonprofits only

#241911

TPA catabolic operon under the control of a PCA inducible biosensor

Neil Dixon

Chacon et al Trends Biotechnol. 2025 Mar;43(3):647-67

Aug. 25, 2025

Academic Institutions and Nonprofits only

#90387

IRF3/IRF7 - viral response gene reporter

Ramnik Xavier

O'Connell et al Cell Syst. 2016 May 25;2(5):323-34. doi:

Nov. 11, 2022

Academic Institutions and Nonprofits only

#137735

pCS4333 CEN/ARS vector, PGAL1-yeTadA1.0-100AA linker-T7 RNAP-TCYC1, TRP1 selectable marker

Christina Smolke

Cravens et al Nat Commun. 2021 Mar 11;12(1):1579. doi:

Jan. 29, 2020

Academic Institutions and Nonprofits only