We narrowed to 41,265 results for: ANT
-
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only