We narrowed to 20,136 results for: REN;
-
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX Grb7-SH2
Plasmid#46444DepositorInsertGrb7 (GRB7 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 417-532PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
TagsRenSP (optimized renilla luciferase gene)ExpressionMammalianAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_ TET1 CXXC only
Plasmid#124084PurposeExpression of CXXC domain only form of TET1DepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX Blk-SH2
Plasmid#46407DepositorInsertBlk (BLK Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 119-224PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
TFORF3545
Plasmid#145021PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0849
Plasmid#141733PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX p85b(N)-SH2
Plasmid#46467DepositorInsertp85b(N) (PIK3R2 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 318-431PromoterTacAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
HOXB1 (human) HIS-tag pET
Plasmid#8520DepositorAvailable SinceJuly 6, 2006AvailabilityAcademic Institutions and Nonprofits only