We narrowed to 8,067 results for: 104
-
Plasmid#1237DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only
-
TM104b(A503V/A509D)
Plasmid#1161DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
TM104b(G217S/T499I)
Plasmid#1160DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPD1043 TRE3GV mTagBFP2
Plasmid#253903PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and mTagBFP2 in the MCSDepositorInsertmTagBFP2
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTet_KaeCanABC(G104K,G189K)
Plasmid#248958PurposeCanABC from K. aerogenes under control of pTet and the native promoter, with ChyC mutated (G104K,G189K)DepositorInsertKaeCanABC(G104K,G189K)
ExpressionBacterialMutationG104K,G189KAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
zPRL3_1-169_C104D_pET-15b
Plasmid#250560PurposeBacterial expression of zebrafish PRL3/PTP4A3 C104DDepositorInsertzebrafish PRL3 (ptp4a3a Zebrafish)
TagsHis-tagExpressionBacterialMutationCysteine 104 to Aspartic acid (C104D)Available SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-parkin R104A
Plasmid#227358PurposeFor bacterial expression of parkin with a mutated ACT.DepositorInsertParkin R104A (PRKN Human)
TagsGSTExpressionBacterialMutationCodon usage optimized for E.coli expression. Chan…Available SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-F104C
Plasmid#220296Purposemammalian expression of Bcl-2-F104C tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only