We narrowed to 13,309 results for: sequence
-
Plasmid#162559PurposeExpresses C. elegans iPGM containing a C-terminal biotinylation site and His tagDepositorInsertC. elegans iPGM bio-6His (ipgm-1 Nematode)
Tags6His tag, T7 tag, Thrombin cleavage site, and bio…ExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a Bm-iPGM-bio
Plasmid#162565PurposeExpresses B. malayi iPGM containing a C-terminal biotinylation site and His tagDepositorInsertB. malayi iPGM bio-6His
Tags6His tag, T7 tag, biotinylation sequence, and thr…ExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLI
Plasmid#131228PurposeExpression of WT DNA polymerase iota with an N-terminal FLAG tag in mammalian cellsDepositorInsertDNA polymerase iota (POLI Human)
TagsFLAGExpressionMammalianMutationCoding sequence has been codon optimised for expr…PromoterCMV enhancer + CMV promoterAvailable SinceDec. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-Fc-His
Plasmid#72124PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
mMib1-FLAG
Plasmid#37116DepositorInsertMib1(Mus musculus mindbomb homolog 1 (Drosophila) (Mib1)) (Mib1 Mouse)
Tags3 x FLAGExpressionMammalianMutationACC Kozak sequence added before ATG annotated.PromoterCMVAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE4GamRA-P2A-Puro
Plasmid#112673PurposeLentivirus for constitutive expression of BE4GamRA in mammalian cells (codon optimized)DepositorInsertBE4GamRA
UseLentiviralTagsFLAGMutationNLS sequence at the N-terminus and D10APromoterEF1sAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
proE-cad178-Luc-mEbox
Plasmid#42082DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -178 to …PromoterE-cadherinAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only