We narrowed to 13,309 results for: sequence
-
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
TrHKI-pGFPN3
Plasmid#21918DepositorInsertTruncated human HKI (lacking exon 1 sequence that encodes for the mitochondrial binding domain) in pGFP-N3 plasmid (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKI cDNA (lacking exo…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-AP-His
Plasmid#72039PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-MBP-4xDQNAT
Plasmid#128398PurposePeriplasmic expression of E. coli MBP with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertMaltose binding protein
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialMutationY342H- please see depositor commentsPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-AP-His
Plasmid#72040PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-TAPBPR-TM
Plasmid#178645PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TMDepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationswitched transmembrane domain with that of MHC-IPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5E-1.7kbfabp6
Plasmid#159087Purposep5E with promoter sequence 1.7kb upstream of zebrafish fabp6 geneDepositorInsert1.7kb fabp6 promoter (fabp6 Zebrafish)
UsePromoter fragment 5' entry vector for tol2 c…Promoter1.7kb fabp6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only