Showing: 21 - 27 of 27 results
-
Plasmid#209757PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationMutations to disrupt the uORFs and the stem-loop …PromoterAvailabilityAcademic Institutions and Nonprofits only -
pEC1.2/EC1.1_spCas9_GFP
Plasmid#161933PurposeCRISPR plasmid with spCas9 expressed under egg cell promoter - GFP seed selectionDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pEC1.2/EC1.1_spCas9_TagRFP
Plasmid#161934PurposeCRISPR plasmid with spCas9 expressed under egg cell promoter - TagRFP seed selectionDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 21 - 27 of 27 results