Showing: 61 - 80 of 80 results
-
Plasmid#136015PurposeZC3H15 3'UTR (NM_018471.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertZC3H15 3'UTR (ZC3H15 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Reverse-Complement
Plasmid#136016PurposeThe Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (Reverse Complement) (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-TMED3-Reverse-Complement
Plasmid#136018PurposeThe Reverse Complement of TMED3 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertTMED3 3'UTR (Reverse Complement) (TMED3 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-ZC3H15-Reverse-Complement
Plasmid#136019PurposeThe Reverse Complement of ZC3H15 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertZC3H15 3'UTR (Reverse Complement) (ZC3H15 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552-Unstructured
Plasmid#136028PurposeEIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B-465-552
Plasmid#136029PurposeEIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-Delta-Hairpin
Plasmid#136030PurposeEIF3B (465-552) 3'UTR with the main hairpin deleted inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-1st-Hairpin
Plasmid#136031PurposeEIF3B (465-552) 3'UTR with only the main hairpin inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-Disrupted-Hairpin
Plasmid#136032PurposeEIF3B (465-552) 3'UTR with the main hairpin mutated inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-Restored-Hairpin
Plasmid#136033PurposeEIF3B (465-552) 3'UTR with the main hairpin restored inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-A:U-Hairpin
Plasmid#136034PurposeEIF3B (465-552) 3'UTR with the main hairpin mutated to A and U nucleotides only inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 61 - 80 of 80 results