We narrowed to 20 results for: puc

1. Plasmids 101: Origin of Replication

   Type

   Blog Post

   ...pMB1 ori maintains about 20 copies per cell, while pUC – which differs by only two mutations – will produce...Copy Number+ ori Incompatibility Group Control pUC ~500-700 pMB1 (derivative) A Relaxed pBR322 ~15... (derivative) and F1** A Relaxed pGEM ~300-500 pUC and F1** A Relaxed pCDF ~20-40 CloDF13 (CDF) D...

2. Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

   Type

   Blog Post

   ... 4 kits also contain the two entry vectors pUC-L1L4 and pUC-L3L2. Find the 2in1 plasmid kits at Addgene...cloning system contains two entry vectors (pUC57-L1L4 and pUC57-L3L2) that offer the advantage of using ...

3. Plasmids 101: A Brief History of Plasmids and an Improved eBook!

   Type

   Blog Post

   ...and new cloning vectors such as pBR322, pACYC, and pUC were developed to provide higher copy number vectors...

4. Stabilized Bacterial Promoters: Constant Gene Expression at any Copy Number

   Type

   Blog Post

   ...number of plasmids per cell increases 4-5 fold (for pUC plasmids) or ~2 fold (for p15a, R6K, and ColE2 plasmids...

5. Sequencing Primers

   Type

   Guide

   ...In lacZ gene M13/pUC Forward CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG...

6. Plasmids 101: Dimers and Multimers

   Type

   Blog Post

   ...phase growth. In a study by Williams et al. (2009), pUC multimerization was reduced by growing seed stocks...

7. Protocol - pLKO.1 – TRC Cloning Vector

   Type

   Protocol

   ...selection of pLKO.1 plasmid in bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long...

8. CRISPR Plasmids - Plants

   Type

   Collection

   ... rice snoRNA U3 BsaI none S. pyogenes Yang 47024 pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott...pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295...

9. Rinehart Lab Phosphoprotein Reagents

   Type

   Collection

   ...compatible with other plasmids containing high copy ColE1/PUC-like origins. Therefore, when choosing plasmids to...

10. CRISPR Plasmids - Empty gRNA Vectors

    Type

    Collection

    ...Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089 Mammalian BsaI none S. pyogenes Huang...Lourido pRGE31 50929 Plant BsaI none S. pyogenes Yang pUC gRNA Shuttle 47024 Plant inFusion none S. pyogenes... 47108 Mammalian BbsI none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none...:AtU6p 46968 Plant BsaI none S. pyogenes Kamoun pUC119-gRNA 52255 Plant PCR template none S. pyogenes ...pHSE401 62201 Plant yes, cut S. pyogenes Hyg Chen pUC57-Simple-gRNA backbone 51306 Xenopus BsaI none S. ...