...pMB1 ori maintains about 20 copies per cell, while pUC – which differs by only two mutations – will produce...Copy Number+ ori Incompatibility Group Control pUC ~500-700 pMB1 (derivative) A Relaxed pBR322 ~15... (derivative) and F1** A Relaxed pGEM ~300-500 pUC and F1** A Relaxed pCDF ~20-40 CloDF13 (CDF) D...

... 4 kits also contain the two entry vectors pUC-L1L4 and pUC-L3L2. Find the 2in1 plasmid kits at Addgene...cloning system contains two entry vectors (pUC57-L1L4 and pUC57-L3L2) that offer the advantage of using ...

...and new cloning vectors such as pBR322, pACYC, and pUC were developed to provide higher copy number vectors...

...number of plasmids per cell increases 4-5 fold (for pUC plasmids) or ~2 fold (for p15a, R6K, and ColE2 plasmids...

...phase growth. In a study by Williams et al. (2009), pUC multimerization was reduced by growing seed stocks...

...In lacZ gene M13/pUC Forward CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG...

...selection of pLKO.1 plasmid in bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long...

... rice snoRNA U3 BsaI none S. pyogenes Yang 47024 pUC gRNA Shuttle Mt U6.6 inFusion none S. pyogenes Parrott...pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295...

...p201G Cas9 ; p201B Cas9 ; p201H Cas9 ; p201N Cas9 ; pUC gRNA Shuttle PDF 488.6 KB Sabatini and Lander gRNA...

...compatible with other plasmids containing high copy ColE1/PUC-like origins. Therefore, when choosing plasmids to...