We narrowed to 27 results for: U6 promoter

.... U6 small RNA expression shRNA From the human U6 small nuclear promoter Constitutive  Murine U6 is ... trying to pick your perfect promoter! Eukaryotic Promoters   Promoter   Primarily used for RNA     .... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...cell types or organisms, promoters must be similarly variable. Bacterial promoters only work in prokaryotic...

...sequence downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer than four gRNAs...from its own promoter. But that doesn’t mean you have to clone and transfect multiple promoter-gRNA constructs... of pX330, contains humanized wtCas9 and two U6 promoters. To use this plasmid, you simply order oligonucleotides...to three gRNAs. Entry vectors containing the U6 promoter and the gRNA scaffold are provided with the kit...cloning. gRNAs are expressed from two Drosophila U6 promoters. Cas9 must be supplied on a separate plasmid...can I express more than one gRNA from a single promoter using a plasmid like pX330? Unfortunately, the...contain Type IIS restriction sites flanking the promoter-gRNA construct, but with different sequences adjacent...

...customizable sgRNA from the U6 promoter and puromycin resistance from the EF-1a promoter. It’s a 3rd generation...the years on their own or through Addgene!) pX330-U6-Chimeric_BB-CBh-hSpCas9 - The S. pyogenes Cas9 (SpCas9...cloned to create a chimeric guide RNA. Find pX330-U6-Chimeric_BB-CBh-hSpCas9. pSpCas9(BB)-2A-Puro (PX459...

...first site accepts the sgRNA target sequence for U6 promoter expression and the second site accepts the homology...containing a direct fusion of the desired gRNA to the U6 promoter, and a second plasmid containing the homology...regions of homology to the gene of interest to promote homology directed repair after a CRISPR/Cas9 induced...

...imporant is that, upstream of the Cbh promoter, this plasmid has a U6 promoter followed by BbsI restriction sites...pyogenes (Sp) Cas9 from a Cbh promoter. Cbh is a modified version of CAG promoter that the Zhang lab has tested...

...strategy, the need for lengthy promoters, such as U6 or EF1α promoters, has limited the number of gRNAs...assembled tRNA-gRNAs is placed downstream of a lengthy promoter, which is used to drive the expression of the ...expression of itself, without using any additional promoter, which is followed by tRNA processing to release...human or plant sources) in both the strength as a promoter and the activity to release gRNAs from DAP array...-gRNA arrays, that rely on an upstream lengthy promoter to express the gRNA array, DAP arrays use tRNA...

...pC016 - LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing:...

...Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA...are described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...tyroxine binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be...PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor)... directed repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This ...

...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...Drosophila U6:3 pegRNA BbsI No Vermilion Norbert Perrimon 149546 pCFD5-NS Drosophila Drosophila U6:3 pegRNA...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...top Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Drosophila ...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...Vermilion Norbert Perrimon 164423 pHSG1C3 Mammalian U6 pegRNA + nicking sgRNA BbsI for sgRNAs; BbsI + PstI...

...sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to add a...the start of my target sequence? A3: The human U6 promoter prefers a 'G' at the transcription start site...of the crRNA) is also expressed from a separate promoter. In the pre-processing form, the crRNA contains...

...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid.... Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau et al. (2009...Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puromycin selection...

...expression vector Promoter driving Cas9 expression can be constitutive or inducible. U6 promoter is typically...

...polymerase III promoters, which transcribe small RNAs. The most common promoters are U6, H1, and 7SK. ...sequence Choosing the plasmid backbone Choosing the promoter Mature siRNAs typically range from 19–22 nucleotides.... These are strong promoters with no tissue specificity, so in some cases they can lead to toxicity and...plasmids are being designed using RNA polymerase II promoters. The design of these plasmids is meant to more...closely mimic pre-miRNAs, and the use of the pol II promoters allows for more flexibility in expression levels...integrated expression atlas of miRNAs and their promoters in human and mouse. Nature Biotechnology, 35(9...Targeting RNA with Cas13a (C2c2) Plasmids 101: The Promoter Region – Let's Go! Browse All Plasmids 101 Posts...

...expresses S. pyogenes Cas9 from the PGK promoter) and U6 promoter-driven guide RNA constructs, pAdSh.U6....

...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...containing a promoter for constitutive (CMV, SV40, SFFV) or inducible (CMV-TO) cDNA expression, sgRNA (U6) expression...the available sgRNA-cargo constructs utilize a U6 promoter and contain the RNA cargo cassette inserted within...

...express hybrid Cas9-Cas12a gRNAs under a single U6 promoter. The paralog and dual-targeting hybrid gRNA library...

...Corn under promoters for transcripts uniquely transcribed by RNA Polymerase III (5S, tRNA and U6) and measuring...transcription by placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores ...

...and pX458 modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter ...reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids...shuttle plasmids to insert a second guide within a U6-guide cassette. This process is compatible with all...

...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1-mcherry...190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-...7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's...Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9 HTT GFP U6, EFS Huntington's Nicole Deglon 191487...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...(BRDN0001145663) TBK1 U6 ALS David Root 76362 TBK1 gRNA (BRDN0001148392) TBK1 U6 ALS David Root 76363 ... (BRDN0001148607) TBK1 U6 ALS David Root 76470 GAK gRNA (BRDN0001146687) GAK U6 Parkinson's David Root...

....org/10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription ...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...

...sgRNA design note When expressing gRNAs from a U6 promoter, remember that transcription typically requires...

...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2... EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG...

...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al., ...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...

...the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...continuous expansion of compatible backbones, promoters, and genes available to the community. If you ...

...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...plasmids. ID Plasmid Luciferase Type Promoter Description PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow... Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase...

...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter for small RNA expression (species-specific...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... binding to the promoter region. Each sigma factor recognizes different core promoter sequences. Figure...