...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...

...Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...

... hybrid LTR promoter (more information on this below). Additional or specialized promoters may also be...internal promoter is provided, gene expression is driven by the 5'LTR, which is a weak promoter and requires...heterologous promoter on the transfer plasmid. Expression of the transgene from this promoter is no longer... within a transfer plasmid: for example, the U6 promoter is included in the pSico plasmid to drive shRNA...lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol III-directed transcription...generation lentiviral plasmids utilize the viral LTR promoter for gene expression, whereas 3rd-generation transfer... eliminates the requirement for Tat. LTR Viral Promoter Wild type Hybrid: 5'LTR is partially deleted and...

...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...and targeting these dCas9 fusion proteins to the promoter region results in robust transcriptional repression...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...activation and repression libraries will target promoter or enhancer regions. Be sure to check the library...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...activator (such as dCas9-VP64) gRNA(s) targeting promoter elements of target gene Many different activators...