Skip to main content
Addgene
Showing: 1 - 30 of 35 results
  1. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ...Targeting pEF-BFP with a cytidine deaminase base editor results in shift in emission spectra from BFP to GFP....293 cells with the BFP variant, a BE4am-Cas9 base editor, and sgRNA vectors for the BFP-to-GFP conversion...deaminase base DNA editor. Specifically the BFP mutant (BFPH66) contains a histidine at amino acid 66. This...an integrated GFP reporter that is converted into BFP (blue fluorescent protein) upon CRISPR/Cas9 homology...Glasser et al., 2016). For TREE they engineered a BFP variant that undergoes conversion to GFP after being...from the Wang and Brafman lab uses an engineered BFP variant that converts to GFP after a base editing...nature24644 Glaser A, McColl B, Vadolas J (2016) GFP to BFP Conversion: A Versatile Assay for the Quantification...
  2. Top Requested AAV of 2017: pmSyn1-EBFP-CRE

    Type
    Blog Post
    ... of interest makes pmSyn-BFP-Cre highly modular. Further uses of pmSyn1-EBFP-Cre Of course there are also...requested AAV that became available in 2017 is pmSyn1-EBFP-Cre from Hongkui Zeng’s lab. This AAV has had over...over 150 orders since coming online! pmSyn1-EBFP-Cre Available in serotypes AAV1, AAV5, and AAV retrograde... your Cre-dependent mCherry mouse with the pmSyn-EBFP-Cre AAV. Because Cre expression is controlled by...re excited to see how you continue to use pmSyn1-EBFP-Cre and other viral vector tools in the years to... pmsyn1-ebfp-cre...
  3. Plasmids 101: FLEx Vectors

    Type
    Blog Post
    ... want to design a genetic FLEx switch that turns BFP expression off, while turning on mCherry expression...successfully work, the cassette would need to contain the BFP coding sequence in the sense orientation, followed...Nat Biotech 2003): Basic FLEx switch will express BFP in the absence of, or mCherry in the presence of ...specifically drives expression of mCherry instead of BFP. Beyond switching fluorophores, why is FLEx useful...
  4. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ... range).  By mutating GFP, the variants blue FP (BFP), cyan FP (CFP), and yellow FP (YFP) were derived...will pass blue light to the detector/camera, then BFPs are of no use to you. When using more than one FP... light. Photostability can be as short as 100ms (EBFP) or as long as 1 hour (mAmetrine1.2). However, for...
  5. New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression

    Type
    Blog Post
    ...FACS, gating for the top quartile (or higher) of BFP and GFP producing cells. After FACS, return the cells...cotransfect a mixture of 1248 ng of CMV-gvpA-IRES-BFP plasmid and 954 ng CMV-gvpNJKFGWV plasmid into 70%...contains the major structural gene gvpA marked with EBFP2 and the second cassette contains the P2A-linked ...
  6. Qi Lab CRISPR Page

    Type
    Collection
    ...plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion expression...pHR-SFFV-dCas9-BFP Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP 46911...to 2x NLS, tagBFP and a KRAB domain 46912 pMSCV-LTR-dCas9-VP64-BFP Human expression vector containing MSCV...46911 pHR-SFFV-dCas9-BFP-KRAB Human expression vector containing SFFV promoter, dCas9 that is fused to ...targeting human telomeres 46913 pMSCV-LTR-dCas9-p65AD-BFP Human expression vector containing MSCV LTR promoter...promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFP 51023 pSLQ1658-dCas9-EGFP Human expression vector...that is fused to 2x NLS, p65 activation domain and tagBFP 46914 pU6-sgGFP-NT1 Human pSico-based U6 vector...
  7. Control AAV Preps

    Type
    Collection
    ...dependent 9 Wickersham 137130 pAAV-Ef1a-Con/Foff 2.0-BFP EF1a BFP Cre dependent 8 Deisseroth 137133 pAAV-Ef1a-...dependent 1 Gradinaru 137131 pAAV-Ef1a-Coff/Fon-BFP EF1a BFP Flp dependent 8 Deisseroth 137134 pAAV-Ef1a-...dependent 8, rg* Deisseroth 137129 pAAV-Ef1a-Con/Fon-BFP EF1a BFP Cre and Flp dependent 8 Deisseroth 137132 pAAV-Ef1a-Con... dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes 45186 AAV-EF1a-BbChT...
  8. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...endosomes Rab5 mCherry Gia Voeltz 49147 BFP-Rab5 Early endosomes Rab5 BFP Gia Voeltz 61802 GFP-Rab5B Early endosomes...Sec61 mCherry Gia Voeltz 49154 BFP-Sec61 beta Endoplasmic Reticulum Sec61 BFP Gia Voeltz 73209 pcDNA3.1-kappa-myc-dL5... Snapp 68126 ERoxBFP Endoplasmic Reticulum ER retention signal oxBFP Erik Snapp 49150 BFP-KDEL Endoplasmic...St-Pierre 49151 mito-BFP Mitochondria mitochondrial targeting signal (COX4) TagBFP Gia Voeltz 55102 mCherry-Mito...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-...James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson 12674 GFP-...
  9. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...Structure Plasmids: ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules...-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP mCherry-Drp1...dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize ...
  10. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 WT] TARDBP CMV ALS Rajat Rohatgi 107840 pHBS1108 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 ∆CTD] TARDBP CMV ALS Rajat Rohatgi 107842 pHBS1138 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 F-S] TARDBP CMV ALS Rajat Rohatgi 107844 pHBS1203 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 4xsigma] TARDBP CMV ALS Rajat Rohatgi 107846 pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 N-Q] TARDBP CMV ALS Rajat Rohatgi 107848 pHBS1335 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309S] TARDBP CMV ALS Rajat Rohatgi 107850 pHBS1339 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309F] TARDBP CMV ALS Rajat Rohatgi 107852 pHBS1338 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...
  11. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...derivatives) Y145F Increases quantum yield for BFP Y145A and H148D Stabilizes the structure of Cerulean... Y66W, S72A, Y145A, H148D, N149I, M153T, V163A EBFP F64L, S65T, Y66H, Y145F   Table 2: Functional...
  12. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...pDAS12222_U6-pegRNA-BFP Mammalian hU6 pegRNA BpiI for pegRNA, Esp31 for PBS-RT No BFP Ervin Welker Do you...
  13. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Kuhn pU6-(BbsI)_CBh-Cas9-T2A-BFP 64323 Mammalian BbsI yes, cut S. pyogenes BFP Kuhn pU6-(BbsI)_CBh-Cas9-T2A-mCherry...)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B 64218 Mammalian see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro...cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S. pyogenes Puro ...N. meningitidis Pederson pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6 64220 Mammalian U6 yes, cut S. pyogenes...-U6gRNA(BbsI)-PGKpuro2ABFP 50946 Mammalian/Lentiviral BbsI none S. pyogenes Puro, TagBFP Yusa lentiGuide-Puro...gRNA_handle_U6t 49016 Mammalian SacI none S. pyogenes EBFP Lu pH1v1 60244 Mammalian Gibson none S. pyogenes... S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI none S. pyogenes...
  14. Deisseroth INTRSECT Collection

    Type
    Collection
    ...137129 pAAV-Ef1a-Con/Fon-BFP Cre AND Flp Yes 137130 pAAV-Ef1a-Con/Foff 2.0-BFP Cre AND NOT Flp FRT/F5 Yes... Yes 137131 pAAV-Ef1a-Coff/Fon-BFP Flp AND NOT Cre Yes 137132 pAAV-Ef1a-Con/Fon-mCherry Cre AND Flp Yes...
  15. Validated gRNA Sequences

    Type
    Collection
    ...ACAGTGGGGCCACTAGGGAC cut S. pyogenes 26789497 Corn BFP ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn...
  16. MXS Chaining

    Type
    Blog Post
    ... Tethering partner Subcellular localization 1 TagBFP 399nm/ 456nm histone 2B (H2B) Chromatin 2 Cerulean...
  17. Hot Plasmids Spring 2024

    Type
    Blog Post
    ... by Puromycin, Zeocin®, or nuclear expression of BFP2.     Figure 1: CROPseq-multi uses two sgRNAs...
  18. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and...
Showing: 1 - 30 of 35 results