Skip to main content
Addgene
Showing: 1 - 40 of 91 results
  1. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...pAAV-CaMKIIa-hChR2(H134R)-mCherry 26976 AAV5 pAAV-hSyn-hChR2(H134R)-mCherry 26973 AAVrg pAAV-hSyn-hChR2...pAAV-hSyn-DIO-hM3D(Gq)-mCherry    44362  AAV1 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Controls Plasmid ...pAAV-hSyn-DIO-mCherry 27056 AAVrg pAAV-Ef1a-DIO EYFP 114471 AAV5 pAAV-Ef1a-fDIO mCherry 112677 AAV2...pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry 99130 AAVrg pAAV-mDlx-NLS-mRuby2 112677 AAV1...AAV1, AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP...AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid...
  2. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...pAAV-Ef1a-fDIO mCherry Karl Deisseroth 112677 AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon...pAAV-hSyn-DIO-mCherry Bryan Roth 50457 AAV1 pAAV-hSyn-DIO-EGFP Bryan Roth 114472 AAVrg pAAV-hSyn-mCherry Karl...pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry Connie Cepko 83898 AAVrg pAAV-mDlx-ChR2-mCherry-Fishell-3 Gordon Fishell...Flp-dependent expression of ChR2(H134R) bound to an mCherry reporter. We now also offer AAVrg for plasmid 83898... Depositor 44361 AAV1 pAAV-hSyn-DIO-hM3D(Gq)-mCherry Bryan Roth   Recombinases Recombinase systems...Serotype Name 44362 AAV1 pAAV-hSyn-DIO-hM4D(Gi)-mCherry 83896 AAVrg pAAV-hDlx-GiDREADD-dTomato-Fishell...Plasmid Serotype Name 114471 AAV2 pAAV-Ef1a-fDIO mCherry 83900 AAVrg pAAV-mDlx-GFP-Fishell-1 Biosensors...
  3. Top Requested Lentivirus and AAV of 2016

    Type
    Blog Post
    ...anti-mCherry antibody rather than endogenous mCherry fluorescence when visualizing hM4D(Gi)-mCherry in ...gene knockout. Top AAV: pAAV-hSyn-DIO-hM4D(Gi)-mCherry Our current AAV inventory consists almost entirely...these viruses are popular, pAAV-hSyn-DIO-hM4D(Gi)-mCherry contains a double floxed human muscarinic receptor...receptor 4 (Gαi-coupled) DREADD fused to mCherry, all under the control of the human synapsin promoter. Purpose... Purpose of this AAV pAAV-hSyn-DIO-hM4D(Gi)-mCherry can be used to induce neuronal silencing in vitro ...Aschauer et al., 2013). Expression of hM4D(Gi)-mCherry from this virus is cre-dependent, meaning that ...2011). Viruses expressing pAAV-hSyn-DIO-hM4D(Gi)-mCherry are typically injected into brain regions of mice...
  4. Top Requested AAV of 2017: pmSyn1-EBFP-CRE

    Type
    Blog Post
    ... with mCherry and you already have a transgenic mouse line that contains a Cre-dependent mCherry cassette...with mCherry controlled by a neuron specific promoter or you could breed your Cre-dependent mCherry line...incredible growth this year. pAAV-hSyn-DIO-hM4D(Gi)-mCherry was the top requested AAV prep for the 2nd year...you need would be to inject your Cre-dependent mCherry mouse with the pmSyn-EBFP-Cre AAV. Because Cre ...controlled by the synapsin promoter, it and therefore mCherry will only be expressed in neurons. Indeed, this...
  5. Opto-Nanobodies: Using Light to Manipulate Cell Signaling and Protein Purification

    Type
    Blog Post
    ...these experiments.  AsLOV2 Inertion Site mCherry #1 mCherry #2 GFP Loop 1 dark-induced dark-induced...Toettcher Lab monitored how AsLOV2 insertion into mCherry or GFP nanobodies affected binding of their target... its co-localization with a membrane-localized mCherry or GFP protein. With this system, if the OptoNB...sites in all eight surface-exposed loops of an mCherry nanobody. Only insertion into loops 1 and 6 resulted...scheme to generate two more OptoNBs, one against mCherry and one against GFP. Insertion of AsLOV2 into loop...which revealed a blue light-dependent shift in mCherry fluorescent to the surface of the bead, suggesting... a membrane localized GTPase, the team fused a mCherry OptoNB to the catalytic domain of the Sons of Sevenless...
  6. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-NLS-GFP pAAV-hSyn-mCherry Read on to learn more...pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP,and pAAV-hSyn-mCherry at Addgene. Viral ...114472  AAV5, AAV8  pAAV-hSyn-mCherry 50459  AAVrg  pAAV-hSyn-DIO-mCherry 59462  AAV2  pAAV-CAG-tdTomato...Serotype Name 75033  AAV1  pAAV CD68-hM4D(Gi)-mCherry (CD68 is a  microglia/macrophage promoter) 121539...pAAV-EF1a-fDIO-Cre (FLP-dependent CRE) 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Calcium...
  7. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ... mutated mCherry and a downstream constitutively active eGFP. To create the inactive mCherry, the lab ...downstream of wild-type mCherry and a T2A site and expressed in cells. mCherry is constitutively expressed...dividing the number of eGFP and mCherry positive cells by the number of only mCherry positive cells (Martin et... (5’-TCA-to-TUA) found within the 43 base-pair mCherry insertion. Editing of these motifs generates lesions...two DSBs that can be repaired by NHEJ restoring mCherry expression. Cells can then be sorted using Fluorescence-activated...only eGFP expression to cells expressing eGFP and mCherry. ACE was used to identify cells that have been ... relies on the restoration of a frame-shift in mCherry that restores fluorescence to monitor APOBEC-Cas...
  8. Tagging Optogenetics and Chemogenetics Receptors: Fluorescent Proteins and Other Options

    Type
    Blog Post
    ...interest. The green fluorescent protein (GFP) and mCherry, two of the most common tags currently used, are...used a construct in which the hM4Di was fused to mCherry. To investigate the localization of the hM4Di, ..., we used primary antibodies against mCherry, and secondary antibodies coupled to nanogold particles, ...proteins Given the limited expression of hM4Di‐mCherry at the plasma membrane in monkey neurons, we next...small change made a big difference. Replacing the mCherry with the HA tag resulted in abundant expression... of the transgene of interest. In our studies, mCherry interfered with the transport to the membrane of...technique was used to reveal the hM4Di coupled to mCherry (top) or HA tag (bottom). The images show examples...
  9. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    ...iteration was named GEmCherry1, due to the “genomic fragment inserted into mCherry”. However this one ...AAVS1 locus using GEmCherry2. In this experiment they saw a clear difference in mCherry expression using...CRISPR genomic target region into the N-terminus of mCherry. To prevent alternative start site initiation, ...genomic region inserted into the N-terminus of mCherry can be targeted by a sgRNA guided Cas9 causing ...or deleted, can result in an in-frame shift of mCherry and thus expression. As a proof of concept the ... 2: The GEmCherry reporter. Image from Højland Knudsen et al., 2018. So how does GEmCherry2 work? The...stem cells.  Find GEmCherry2 reporter plasmids at Addgene Overall SRIRACHA and GEmCherry2 reporter systems...
  10. A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light

    Type
    Blog Post
    ...VVD and the DNA-binding domain of AraC using a mCherry reporter downstream of a PBAD promoter. While none...created two constructs, among others: pBLADE-mCherry: This construct, built from the pBAD33 backbone...backbone, contains BLADE, the PBAD promoter, and a mCherry reporter downstream of the PBAD promoter. To use ... with your gene of interest, you would replace mCherry with your gene of interest. pBLADEONLY: This plasmid...with pBLADE expressing superfolder GFP instead of mCherry under the PBAD promoter. They created a bacterial...
  11. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...pAAV-hSyn-hChR2(H134R)-mCherry (26976-AAV5) pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5) ...GABAergic interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a ... a Cre-dependent switch that expresses nuclear mCherry in the absence of Cre, and expresses nuclear EGFP...DreO-bGHpA (50363-AAV5) Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1...
  12. Choosing Your Fluorescent Proteins for Multi-Color Imaging

    Type
    Blog Post
    ...both mCherry and TagRFP.  Here, the TagRFP spectrum is shown in the darker colors and the mCherry spectrum...larger fraction of the TagRFP emission than the mCherry emission. For this filter set, we would expect ...expect TagRFP to give a brighter signal than mCherry. In general, filter sets designed for Rhodamine / Cy3 ...or mRuby2 than longer wavelength proteins like mCherry. For background on fluorescence and filter sets...
  13. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...-hM3D(Gq)-mCherry AAV1 Chemogenetics Bryan Roth New serotype pAAV-CaMKIIa-hM4D(Gi)-mCherry AAV1 Chemogenetics...pAAV-hSyn-hM3D(Gq)-mCherry AAV1 Chemogenetics Bryan Roth New serotype pAAV-hSyn-hM4D(Gi)-mCherry AAV1 Chemogenetics...Control Gordon Fishell New viral prep pAAV_BiSSTe10_ChR2_mCherry AAV-PHPeB Optogenetics Gordon Fishell...Control Gordon Fishell New viral prep pAAV_BiCHATe27_ChR2_mCherry AAV-PHPeB Optogenetics Gordon Fishell...Control Gordon Fishell New viral prep pAAV_BiVIPe4_ChR2_mCherry AAV-PHPeB Optogenetics Gordon Fishell ...Control Gordon Fishell New viral prep pAAV_BiLAMP5e3_ChR2_mCherry AAV-PHPeB Optogenetics Gordon Fishell...Control Gordon Fishell New viral prep pAAV_BiPVe4_ChR2_mCherry AAV-PHPeB Optogenetics Gordon Fishell ...
  14. New Viral Vectors - March 2024

    Type
    Blog Post
    ... pAAV-CaMKIIa-mCherry  AAV PHP.eB Controls Deisseroth New serotype pAAV-Ef1a-mCherry  AAV PHP.eB Controls...New viral vector pAAV-nEF-Con/Foff DREADD Gi-mCherry AAV8 Chemogenetics Deisseroth New viral vector ...
  15. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ...114472  AAV5, AAV8 pAAV-hSyn-mCherry 50459  AAV9, AAVrg pAAV-hSyn-DIO-mCherry 37825 AAV1, 2, 5, 8, 9 ...Serotype Name 75033  AAV1 pAAV CD68-hM4D(Gi)-mCherry 50467  AAV2 pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine...Plasmid Serotype Name 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Chemogenetics...
  16. Hot Plasmids - February 2022

    Type
    Blog Post
    ...4x-FLAG-mCherry-H2B), cytoskeletal (middle, 4xFLAG-mCherry-β-actin), and mitochondrial (mito-mCherry-1xFLAG...while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG frankenbody...
  17. Plasmids 101: FLEx Vectors

    Type
    Blog Post
    ...that turns BFP expression off, while turning on mCherry expression. For this FLEx switch to successfully...sequence in the sense orientation, followed by the mCherry coding sequence in the antisense orientation (Figure... switch will express BFP in the absence of, or mCherry in the presence of Cre recombinase.   Once ... plasmid now specifically drives expression of mCherry instead of BFP. Beyond switching fluorophores, ...
  18. Synthetic promoter AAVs for cell-type specific expression in retinal cells

    Type
    Blog Post
    ...only result in cells where Cre-mCherry is also expressed. If Cre-mCherry expresses in photoreceptors and... using one promoter to drive expression of Cre-mCherry and a second promoter to drive expression of a ...cells transduced by both AAVs would express Cre-mCherry and GFP.   Figure 2: Synthetic promoters ...
  19. Viral Production at Addgene

    Type
    Blog Post
    ...in the absence of Cre. mCherry expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from...Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes...
  20. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...traditional homologous recombination methods). By using mCherry for selection of sgRNA plasmid transformants, they...with the sgRNA cassette on a plasmid expressing mCherry and resistance selection marker HygR. The CRISPR...disruption of the target gene. Lastly, curing the mCherry-sgRNA plasmid leaves an edited strain carrying ...
  21. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) under the control of Cre recombinase. After in-utero...and synaptic proteins (e.g. postsynaptic PSD95-mcherry) are used in high concentrations in combination...morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the control of Flp recombinase together...
  22. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...designed by putting together the coding sequence of a mCherry fluorescent protein followed by a stop codon and... flow cytometry is used to sort populations by mCherry and GFP expression to check for ABE’s. b) Quantification...
  23. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ... 3’ UTR of the reporter mRNA is labeled by PCP-mCherry (Figure 2). The 3’ UTR also contains a CAAX sequence...membrane; this sequence prevents diffusion of the mCherry labeled mRNA and keeps it in a single field of ...
  24. Hot Plasmids - January 2023

    Type
    Blog Post
    ...promoter drives expression of an mCherry reporter.  After using mCherry for FACS sorting of the weaponized...
  25. Fluorescence Titering Assay

    Type
    Protocol
    ...of pHAGE-TO-dCas9-3XmCherry . 72 h post transduction, cells were assayed for mCherry expression using ...
  26. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ... as the first letter in the protein name, e.g. mCherry). Oxygen: The maturation of the chromophore on ...sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours...
  27. Hot Plasmids - August 2020

    Type
    Blog Post
    ...and modulate transcription of the mCitrine gene. mCherry is constitutively expressed. Cells are then cultured...mDlx-GCaMP6f, hDlx-GiDREADD-dTomato and mDlx-ChR2-mCherry. Find these AAVs at Addgene ...
  28. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...mutagenesis screening for enhanced RFP variants. PA-mCherry (E26V / A58T / K69N / L84F / N99K / S148L / I165V...UV-Violet or blue Green/ Red 4,500 High 553/ 573 PA-mCherries Monomer UV-Violet Dark/ Red >3,000 Medium 570/.... 2.Subach, Fedor V., et al. "Photoactivatable mCherry for high-resolution two-color fluorescence microscopy...
  29. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin...mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or...one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize simultaneously...mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment...
  30. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...reporter activation and silencing of factor-linked mCherry). They additionally discovered that monocistronic...last month, Robert Campbell’s lab added two new mCherry variants to the repository. These variants can ...ONE paper for more on the directed evolution of mCherry and the spectral properties of various RFPs. For...Listen to Our Podcast Segment on PhoCl LSSmCherry1 & RDSmCherry1: Engineering and directed evolution of...influence of structure on an FP’s properties. pBAD-LSSmCherry1 is a long Stokes shift variant, which could be...two-photon microscopy using Ti-Sapphire lasers. pBAD-RDSmCherry1 is a red-shifted variant which, with further ...
  31. Sequencing Primers

    Type
    Guide
    ...forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry, forward primer mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry, reverse primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein...
  32. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...p2A-ferritin-p2A-mCherry Mammalian Expression 74308 pcDNA3.0-Magneto2.0-p2A-mCherry Mammalian Expression...and named it Magneto 2.0. Using Magneto2.0-p2A-mCherry constructs, the lab verified that Magneto2.0 was...Expression 74334 pCR8-Magneto2.0-p2A-mCherry Gateway 74333 pCR8-Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0...AAV 74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain...addition, some versions of the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to...
  33. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ... Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used for...
  34. Chemogenetics AAV Preps

    Type
    Collection
    ...pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi)-mCherry hM4D(Gi...PI 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion Cre-dependent 1, 2, 5, 8,...Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry hM4D(Gi) - Inhibition mCherry fusion Cre-dependent 1, 2, 5, 8,...Roth 50458 pAAV-hSyn-DIO-rM3D(Gs)-mCherry rM3D(Gs) - Activation mCherry fusion Cre-dependent 8 Roth 50474...50474 pAAV-hSyn-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 1, 2, 5, 8, 9, rg* Roth 50475...50475 pAAV-hSyn-hM4D(Gi)-mCherry hM4D(Gi) - Inhibition mCherry fusion none 1, 2, 5, 8, 9, rg* Roth 52536 ...154867 pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA hM4D(Gi) - Inhibition mCherry fusion Flp-dependent 8, rg* ...
Showing: 1 - 40 of 91 results