...gene-function/tet-inducible-expression-systems/tet-systems-legacy-products/tet-on-and-tet-off-2nd-generation...2nd generation Tet-Off vectors (Tet-Advanced)” are the most recent variants of the Tet-Off system.  For...10.1101/gad.2.6.718. PMID: 2843425.Takara Bio. Tet-On and Tet-Off systems: second generation. https://www.takarabio.com...promoters Tet-Off In its native context, the tetracycline repressor (TetR) can bind to the tetracycline operator...operator sequences (TetO), preventing transcription. In the presence of tetracycline (Tet), TetR preferentially...preferentially binds Tet over the TetO elements, allowing transcription to proceed (pJKR-H-tetR from the Church ...to promoters containing TetO elements (often linked in groups of seven as a Tet Response Element (TRE))...

...systems come in two varieties: tet-on and tet-off. As the names imply, tet-off turns off constitutively ...of control. Tet promoters Tetracycline-dependent promoters are engineered by placing tet response elements...proteins while tet-on turns on constitutively silenced proteins. Addition of tetracycline or one of its... Fig. 2 Tetracycline on/off promoters and modes of action Check out Addgene's Lentiviral Tet-on and AAVS1... AAVS1 targeted Tet-on transgene vector. Degron tags Tagging relevant proteins with a degron tag can provide...by titration with different amounts of tetracycline. Tetracycline regulation is reversible (when the drug...

... How to use Tetbow for neuronal labeling To use Tetbow, you can introduce the four Tetbow plasmids (Addgene...expression levels, and we named the system Tetbow (Tetracycline trans-activator Brainbow) (Sakaguchi et al.,...site regularly and hope Tetbow can help you in your research.     To see Tetbow in action, watch the video...low fluorescent protein level. The principle of Tetbow In modern neuroscience, plasmid or viral vector-mediated... of XFPs in the original method, we used the Tetracycline trans-activator system to boost the expression...protocol here.   Tips and troubleshooting your Tetbow experiment Plasmid concentrations and AAV titer...best results. The timing of sacrifice when using Tetbow AAVs - You will have to wait a few weeks to achieve...

...before. But other enzymatic fusions, such as dCas9-TET, can, like the iron ball-and-chain that they resemble...there are a number of drawbacks to this approach: TET proteins are not demethylases; they are dioxygenases...Szyf 2021, Charlton et al. 2020). Most importantly, TET proteins affect transcription independent of their...2018, Kaas et al. 2013). Figure 2: CRISPR TET-based epigenetic editing. In reality, editing your...demethylation can be achieved by dCas9 alone, without TET (or any demethylase) fusion. This may seem counterintuitive...demethylation without the confounds inherent to dCas9-TET, allowing one to study the causal relationship between...References Charlton J, Jung EJ, Mattei AL et al. (2020) TETs compete with DNMT3 activity in pluripotent cells...

...is the tetracycline (Tet)-regulated system. You can choose either the Tet-off system or the Tet-on system...system. In the Tet-off system a Tet-response element (TRE) is placed upstream of the promoter in your transfer...expression kinetics as compared to the Tet-off system. One drawback of the Tet system is that it often requires... In the absence of tetracycline or a derivative such as Doxycycline (Dox), the Tet-controlled transactivator... one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA...repress transgene expression. In contrast, in the Tet-on system, tTA has been modified (and renamed rtTA...

...plasmids. Find pLKO.1 - TRC cloning vector. Tet-pLKO-puro - Tet-pLKO-puro contains all the necessary elements...Trono lab that expresses the HIV gag, pol, rev, and tet genes. It can be used with 2nd or 3rd generation ...gene knockdown. Note: this plasmid was called pLKO-Tet-On in the original publication but its name was subsequently...clarify that it does not contain the trademarked Tet-On(R) sold by Clontech. For additional information...the manual provided by the Weiderschain lab. Find Tet-pLKO-puro. lentiGuide-Puro - This plasmid expresses... of shRNA in target cells by the addition of tetracycline/doxycycline to the grown media resulting in ...

...inducible promoters. The positive inducible tetracycline ON (Tet-On) system, a versatile tool developed for...Addgene.org: Inducible Promoters for Bacteria Tetracycline (Tet) On Expression Systems at Addgene Cre-lox ...lot. If you’re looking for high inducibility, the Tet-On system may be a good choice, as it’s documented...require only the addition of an external inducer, like Tet systems, may be activated very rapidly. In contrast...reverse tetracycline-controlled transactivator) is normally inactive and cannot bind the tetracycline response...response elements (TRE) in a promoter. Tetracycline and its derivatives serve as inducing agents to allow...

...chromatin structure at your locus of choice. Find the Tet-inducible caspex plasmid here. Myers SA et al. Nature...Cas9 (dSpyCas9) fused to APEX2 is expressed from a Tet/Shield1 inducible CMV promoter and targeted to a ...

...delivering control shRNAs, GFP, and rtTA from the Tet-on system. The first two can serve as controls in...activate expression of a gene under the control of the tet operator. AAV AAVs are the workhorses of both chemo...

...iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some of these concerns...following reprogramming. This can be overcome by using a Tet-inducible virus to allow for controlled expression...out the links at the end of the post for a list of Tet-inducible reprogramming vectors available from Addgene...Check out these plasmids if you’re interested in Tet-inducible lentiviral expression of OSKM reprogramming...test for mouse iPSCs, tetraploid complementation, involves injecting tetraploid blastocysts with iPSCs...the plasmid in mammalian cells and assists in tethering the vector to the cell’s chromosomes. With the...

...Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression Additional Resources...Bujard tested the tet system in a mammalian cell system (HeLa) and found that the tet system was functional...interest with Strep-Tag and Tet-On 3G transactivator, creating an auto-regulated Tet-On 3G System. Contains...Collections Background Tetracycline Off Tetracycline On Experimental Tips Tet Plasmids Background To advance the...with efficient tetracycline uptake. Search our collection for all tetracycline plasmids. Tet System and the...the Tet Response Element (TRE) A TRE is seven repeats of a 19 nucleotide tetracycline operator (tetO) sequence...developed is known as tetracycline off: in the presence of tetracycline, expression from a tet-inducible promoter...

...RGB proteins under the control of an inducer, i.e. tet-off transactivator (tTA), is injected at a high dose...labeled. Part 2: An AAV expressing the inducer (i.e. tet-off transactivator) is co-injected. The dose of this...

...constitutive promoter. Use this for doxycycline inducible (tet-off) gene expression! We've also added AAV1 and AAV5...

...ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) General protein expression  m15... gal dcm araB::T7RNAP-tetA General protein expression  BLR (DE3) Tetracycline RecA-deficient; best ...not recommended for toxic proteins BL21-A1 Tetracycline Arabinose-inducible expression of T7 RNAP; IPTG...hsdSB (rB- mB-) gal dcm (DE3) Δ(srl-recA)306::Tn10 (TetR) Expression of unstable proteins  HMS174 (DE3...proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin reductase...′[lac+ lacIq pro] (DE3) gor522::Tn10 trxB (StrR, TetR) Expression of insoluble proteins  Rosetta2 (...

...can be used with tetracycline (tet)-inducible expression systems . ID Name Expression System Activity ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1... available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback...Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators...

...and its ability to multiplex repression. Using a Tet responsive promoter to drive expression of a catalytically...pRH2521, respectively. Both dCas9 and the gRNA are Tet-inducible, and a gRNA can be cloned easily into pRH2521...knockdown and developed new, more tightly controlled, Tet responsive promoters to avoid leaky activation of...by L-arabinose and anhydrotetracycline (aTet), respectively. pMAZ-SK contains an aTet-inducible gRNA and...self-destruction" after induction with L-rhamnose and aTet. CRMAGE is much more efficient than traditional ...presence of the inducer, in this case anhydro-tetracycline (aTc). By cloning in two tandem copies of the...Euler CW, Jiang W, Nussenzweig PM, Goldberg GW, Duportet X, Fischetti VA, Marraffini LA (2014) Exploiting...

...Backbones Neomycin (G418) Mammalian Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...vector - Lentiviral shRNA expression Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...Lentiviral shRNA expression Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression... expression pBI-MCS-EGFP - Tet-inducible Transient expression -...destination vector for gene expression (tet inducible) Zeocin/Bleo Mammalian pLenti X1 GFP-Zeo...expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector ...plasmid for mammalian gene silencing (tet-regulated) L4440 - RNAi in C. elegans...

...14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of shRNA; puromycin...EF-1a-driven GFP and shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB...cDNA. Puro selection. Shih 25737 pSLIK-Hygro 3rd Tet-based inducible shRNA or cDNA expression, gateway... other versions of pSLIK. Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression...versions of this plasmid. Root 44012 pInducer20 3rd Tet-inducible lentivirus for ORF expression, multicistronic...See plasmid 21374 for dtomato version. Welm 21916 Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin...

...expression Tyler Jacks Tet-Regulated Lentiviral shRNA Lentiviral vectors for Tet-regulated shRNA expression...Constitutive Lentiviral Cre-regulated Lentiviral Tet-regulated Lentiviral Constitutive Retroviral Resources...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing...expression ID Plasmid Description Tet on or off PI 11643 pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter...

... pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV Mammalian Sauer 11961 pBS596 tet-hCMV-GFPcre...none Mammalian Sauer 11957 pBS595 tet-hCMV-EGFPcre Cre-EGFP fusion Tet inducible Mammalian Sauer 11958 ...Supernova TRE AAV Iwasato 85577 pTC-CMV-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...ApoE.HCR.hAAT Mammalian Ehmer 85578 pTC-ApoE-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...tet-hCMV-GFPcre tet inducible Cre-GFP fusion, metallothionein MT-I region including the polyadenylation site and...and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER) Cre-ERT2 with loxp cassette; Targeting...Mammalian Messing 45359 pNK-TGCK Cre-EGFP fusion; Tet inducible - rrTA expression driven by mouse Nkx cardiac...

... packaging systems, this system incorporates the Tet-off transcriptional activation system to drive high...

...technical developments. Using the Tet-on system, his lab has created a tetracycline cas9 inducible knock-out system...

...including cDNA expression, shRNA-mediated knockdown, Tet and Cre-regulated expression, CRISPR genome editing...

...induced GFP-iPAK4 expressed under promoters like the tet-responsive element (TRE) or the cFos promoter. For...Importantly, even commercial antibodies can be tethered on the viral surface, expanding the range of targetable...

... several tetracycline operators. Transcription can be turned on or off depending on what tet transactivator...General expression mRNA Tetracycline response element promoter Inducible with Tetracyline or its derivatives...

...Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm Expression Kits Kits are...

...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed...

...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling...

...retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses rtTA. See...resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in...

...created constitutive (pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs. For lentiviral expression...Researchers showed that TALE-TET1 constructs, which fused a TALEN to the Tet1 demethylase catalytic domain...with BioRender.com. Tet1 demethylase Ronggui Hu’s lab has created pdCas9-Tet1-CD for targeted cytosine...mammalian cells. This plasmid is used with pcDNA3.1-MS2-Tet1-CD to decrease methylation and activate transcription...lentiviral vector with the same modifier, Fuw-dCas9-Tet1CD, is available from Rudolf Jaenisch’s lab in plasmid... ready-to-use lentivirus. Figure 2: dCas9-Tet1 demethylates cytosines at promoters and enhancers...increased transcription. Created with BioRender.com. Tet1 initiates cytosine demethylation of DNA. However...

...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...

... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...

...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...

... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...

... tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer...forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI, forward primer pBRforEco... primer pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI, reverse primer pCAG-...GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...

...inserting OsTIR1 into the "safe harbor" AAVS1 locus (a tet-inducible OsTIR1 plasmid is also available). Second...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...subunits of the paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive...

...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...

... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ...pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814...

... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...

...gene expression studies, which are evinced by the Tet system and visualization of single molecules via ...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and an inducible...however, remain bound to the mRNA since they are tethered AFTER the stop codon. Thus a non-translated mRNA...MS2 bacteriophage coat protein binding sites to tether many copies of the FP-coat protein fusions to their...

...that can be included in transfer plasmids include: Tet- or Cre-based regulation and fluorescent fusions ...cellular determinant is LEDGF/p75, a lentiviral tethering protein that recruits the pre-integration complex...

...Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 tetR F'[proAB lacIqZΔM15 Tn10(TetR Amy CmR)]  Note: Inactivating ... streptomycin Tn10   Confers resistance to tetracycline Additionally, Table 2 provides a quick reference...recombine.  F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15...supE44 λ-relA1 Δ(lac-proAB)/F' proAB+lacIqZΔM15 Tn10 (TetR) TOP10 Streptomycin MC1061 derivative. General...galE15 galK16 rpsL(StrR) endA1 λ- XL1 Blue Tetracycline Blue/white screening and routine cloning, nalidixic...lacIq Δ(lacZ)M15] hsdR17(rK- mK+)  XL10 Gold Tetracycline and Chloramphenicol High competency cloning ...

...PA-FPs come in 2 flavours- monomeric and tetrameric. Tetrameric PA-FPS are better for whole cell imaging...UV-Violet Cyan/ Green >2,000 Medium 490/ 511 Kaede Tetramer UV-Violet Green/ Red ~2,000 High 572/ 580 tdEos...UV-Violet Green/ Red N/A High 573/ 584 KikGr Tetramer UV-Violet Green/ Red >2,000 High 583/ 593 mKikGR...Monomer Blue Dark/ Red 20 Low 572/ 610 FP595 Tetramer Green Dark/ Red 70 - 1000 Medium 590/ 600 ...to preserve cellular structures (0.5-1% osmium tetroxide). These conditions destroy most PA-FPs, but, in...

...a look at some popular self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from...Commercial ligands available Ease of use Tetracysteine (Cys4) 15 Biarsenical dyes (FlAsH, ReAsH...labeling specificity than short peptide tags like tetracysteine (Jing & Cornish, 2011). HaloTag and SNAP-tag...functional. In some cases, a small peptide tag like tetracysteine might be the only option that doesn’t disrupt...options for CLIP-tag and very few TMP-tag or tetracysteine labeling dyes.  If reaction speed is a priority...

...by L-arabinose and anhydrotetracycline (aTet), respectively. pMAZ-SK contains an aTet-inducible gRNA and...self-destruction" after induction with L-rhamnose and aTet. CRMAGE is much more efficient than traditional ...plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering in human...

... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...

...permeability Bactericidal 10-100 ug/mL Tetracycline tetracyclin Binds 30S ribosomal subunit; inhibits...in foil if a light-sensitive antibiotic like Tetracycline is used. Keep in mind that some E. coli strains...

...so, theoretically, saturated avidin could form tetramers of biotinylated protein. However, oligomerization... GE Life Sciences) or bio-layer interferometry (Octet, Pall ForteBio). Tips for using pMal-T-Avi-His/BirA...for plasmid version 2.0? Instruments such as an Octet may require less in vivo-biotinylated protein (total...

...fluorescent protein that was derived from the tetrameric yellow fluorescent protein (LanYFP) from the ...fluorescent protein mTPF1 is a monomeric version of the tetrameric cyan fluorescent protein from the coral Clavularia...approximately 484 variants, including some potential tetramer-breaking mutations. The library was then screened...

...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and is driven...of the PP7 and MS2 coat protein binding sites to tether many copies of the FP-coat protein fusions to their...these papers did. Since the SunTag-based system tethers mRNAs to the plasma membrane, it’s not appropriate...