Skip to main content
Addgene

We narrowed to 22 results for: DsRed

Showing: 1 - 20 of 22 results
  1. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    ...when Terskikh et al. reported the production of dsRed E5. This timer predictably transitions from green... in the developing pancreas by placing FP timer DsRed-E5 under the control of Neurog3 (a gene controlling... "An enhanced mutant of red fluorescent protein DsRed for double labeling and developmental timer of neural...
  2. Fluorescent Biosensors for Measuring Autophagic Flux

    Type
    Blog Post
    ...cells. This decrease in pH quenches SEP but not DsRed, leading to emission of only red fluorescence. The...proteins: a relatively pH-insensitive RFP variant, DsRed.T3, that’s connected to a pH-sensitive GFP variant...
  3. Retrovirus Plasmids

    Type
    Collection
    ...pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid; deletion of dsRed by Cre recombinase... recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression...
  4. Rosella: A Fluorescent pH-Biosensor for Studying Autophagy

    Type
    Blog Post
    ...C-terminus of DsRed.T3. See Table 1 for a summary of Rosella’s excitation and emission spectra. DsRed is the ...proteins: a relatively pH-insensitive RFP variant, DsRed.T3 and a pH-sensitive GFP variant, super ecliptic...spectra. Component Excitation Emission pH Range DsRed.T3 488, 543*, 568 nm 587 nm ~4.9 - 9 SEP ...
  5. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... RAB7 GFP Richard Pagano 12661 DsRed-rab7 WT Late endosomes RAB7 DsRed Richard Pagano 158006 pCMV-mGold-Lysosome-N...Rab11a GFP Richard Pagano 12679 DsRed-rab11 WT Recycling endosomes Rab11a DsRed Richard Pagano *Fusions to ...Rab5a TagBFP James Johnson 13050 DsRed-Rab5 WT Early endosomes RAB5A DsRed2 Richard Pagano 42307 GFP-EEA1...
  6. Cre-lox system

    Type
    Collection
    ... pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE Cre activates your gene fused to eGFP, removes dsRed. See article...diversity Mammalian Megason 13769 pCALNL-DsRed Cre dependent DsRed expression Mammalian Cepko 13770 pCALNL-GFP...Reporter DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP...expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian Green 22799 Ai9 Rosa26...pLV-CMV-LoxP-DsRed-LoxP-eGFP Switches from DsRed to eGFP expression upon the presence of Cre Lentiviral van Rheenen 28304 pAAV-FLEX-GFP...
  7. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...an NLS from the CMV promoter pAdx-CMV-dsRed 73349 Expresses dsRed from the CMV promoter pAdx-CMV-iCre-p2A-copGFP...
  8. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...dual colour-emission biosensor Rosella consists of DsRed connected to a pH-sensitive variant of GFP (SEP)...Figure 1). The key to the biosensor lies in pH: DsRed is relatively pH-insensitive, while SEP fluoresces...environments that inactivate SEP and leave only DsRed to fluoresce (1). With variants that can be targeted...
  9. CRISPR References and Information

    Type
    Collection
    ...vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (pSIR-hCD2) PDF, 108...donor plasmid backbones pSL1180-HR-PUbECFP & pSL1180polyUBdsRED PDF, 597 KB Zhang gRNA cloning CRISPR RNA...
  10. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...the induction of both DsRed fluorescence and GFP shRNA. Mice carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre...Timer protein - a mutant of the fluorescent protein dsRed that changes irreversibly its color from green to...clonogenic neural stem cells concomitant with activated DsRed2 expression. Brown et al., Genesis 2014 Jan;...
  11. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia Lab Bacterial Vectors ...Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian Expression... Expression DsRed2-C1 - Mammalian Expression DsRed2-pBAD - Bacterial Expression mApple 568 592 37 6.5 ...
  12. Sequencing Primers

    Type
    Guide
    ...primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of DsRed1, forward primer DsRed1-N GTACTGGAACTGGGGGGACAG...GTACTGGAACTGGGGGGACAG (BD Biosciences) 5' end of DsRed1, reverse primer EBV Reverse GTGGTTTGTCCAAACTCATC...
Showing: 1 - 20 of 22 results