Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 596 results
  1. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...Protocol for how to perform a diagnostic digest to verify plasmid size, verify insert orientation, and...expected sizes. This is frequently done after performing either PCR - or restriction enzyme -based cloning...
  2. 10 Steps to a Perfect Science Talk

    Type
    Blog Post
    ...of experimental results in the order they were performed does not make for a memorable presentation anywhere... just plan to reuse a prepared talk unless it perfectly fits the occasion.  I speak on the same topics...
  3. Choosing Your Perfect Empty Backbone

    Type
    Blog Post
    ..., or knocking down YGOI through RNA-mediated interference (e.g. L4440) and observing the downstream effects...additional details and guidance for choosing your perfect plasmid backbone. Or just ask –  leave a message...
  4. Finding Your Perfect Job After University

    Type
    Blog Post
    ...themselves.  Here is my experience looking for the perfect job. Summer work experience in cancer research... good job to list on my CV. Three months was a perfect duration for me because it was sufficient to figure...University of Queensland in Australia, this was a perfect opportunity to work in a genetics lab. As a UK ...acidemia to have the best chance of finding their perfect job.   Resources at Addgene Read Additional Career...
  5. Performing In Vivo CRISPR Screens Using the FITS Approach

    Type
    Blog Post
    ...microenvironments. These screens have primarily been performed in activated T cells, precluding analyses of T...cells. More broadly, this system can be used to perform in vivo screens in other cell types. A key feature...in vivo screens. Figure 1: Using FITS to perform in vivo CRISPR screens to assess T cell responses...
  6. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type
    Blog Post
    ...that function downstream of DNA, such as RNA interference, can reversibly exert their effect independent...independent of gene copy number. RNA interference (RNAi) is a conserved eukaryotic process where approximately...DCL) process the dsRNA into specific types of interfering RNAs.   RNAi vs. CRISPR: Complementary techniques...from a long hpRNA trigger, only a single ~21-nt interfering RNA is produced using shRNA/amiRNA. Although ...Hiwatashi Y, Goshima G (2012) An Inducible RNA Interference System in Physcomitrella patens Reveals a Dominant...Doudna JA (2013) Molecular Mechanisms of RNA Interference. Annu Rev Biophys 42:217–239 . https://doi.org...
  7. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8...
  8. Validated gRNA Sequences

    Type
    Collection
    ... 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes... 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes...AAACAAAACCTCATCAGGCA 68900 interfere S. pyogenes 26918244 Lu PcfiA GAAGCTCACTCCTTAGCACG 68899 interfere S. pyogenes ...74066 interfere S. pyogenes 26829286 Lu pgi C. glutamicum TTGCCTGGAAGTTTGAGTAATGAT 74067 interfere S. pyogenes...74068 interfere S. pyogenes 26829286 Lu pck C. glutamicum TCCAGTTCAGCAGTTCCTTATTCT 74069 interfere S. pyogenes...74070 interfere S. pyogenes 26829286 Lu pyk C. glutamicum ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes.... thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu BT1854 B. thetaiotaomicron...
  9. Viral Production

    Type
    Collection
    ...protocols and performing rigorous quality control (QC). The specific QC experiments performed varies for ...Link opens in a new window) . Transfections are performed using the transfer plasmid, a plasmid encoding...and stored at -80 °C. Titer Titering is either performed by Addgene or by the University of Pennsylvania...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Pennsylvania Vector Core is (as of April 2016) also performed by droplet digital PCR (ddPCR). Quality Control.... To learn which specific QC experiments were performed on your lot, please contact us . Full sequencing...the Viral Genome Next-generation sequencing is performed on viral genomes isolated from the final AAV preparation...
  10. Arf GTPase Family

    Type
    Collection
    ... Plasmid Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... ...members of the RAS superfamily, though recently have been argued to form their own superfamily (Klinger, et ... GTPase signaling activity. Locations of ARF Superfamily members. Figure from Szutl, et al 2019 PMID: ...: 31084567 . More information about ARF Superfamily members can be found in: ARF GTPases and their GEFs... and challenges Sztul E, Chen PW, Casanova JE, Cherfils J, Dacks JB, Lambright DG, Lee FS, Randazzo PA...
  11. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...vector, but their function (cut, nick, activate, interfere, etc.) is limited to that of the Cas protein present...have plasmids with Cas9 that can cut, activate, interfere, or nick. Selection , such as Puromycin or EGFP...Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI ...pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter 48962...pyogenes Bar Chen pBUN6I11 50580 Plant BsaI yes, interfere S. pyogenes Bar Chen pBUN411 50581 Plant BsaI ...pyogenes Hyg Chen pHSN6I01 50587 Plant BsaI yes, interfere S. pyogenes Hyg Chen pHSN501 50589 Plant BsaI ...
  12. Mammalian RNAi Tools

    Type
    Collection
    ...Plasmids for mammalian RNA interference (RNAi) experiments at Addgene; browse by constitutive lentiviral...packaging and expression plasmids Background RNA interference (RNAi) is an RNA-mediated gene silencing mechanism...The dsRNA can be delivered as an siRNA (short interfering RNA) via transfection, or shRNA (short hairpin... 2006. Feb;3(2):109-16. PubMed . In vivo RNA interference demonstrates a role for Nramp1 in modifying ... Tuning silence: conditional systems for RNA interference. Wiznerowicz M, Szulc J, Trono D. Nat. Methods.... PubMed . Cre-lox-regulated conditional RNA interference from transgenes. Ventura A, Meissner A, Dillon...cells, stem cells and transgenic mice by RNA interference. Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers...
  13. CRISPR Guide

    Type
    Collection
    ...Some Acr proteins interfere with DNA binding at the PAM site whereas others interfere with the Cas9 HNH...within the genome. In a perfect world, your gRNA target sequence would have perfect homology to your target...editing technologies. This advantage makes CRISPR perfect for genome-wide screens. This guide will provide.... Ideally, a gRNA targeting sequence will have perfect homology to the target DNA with no homology elsewhere...in robust transcriptional repression (CRISPR interference, or CRISPRi ) or activation ( CRISPRa ) of downstream...chromosome. Browse Plasmids: Activate , Repress/Interfere Epigenetic Modifications Using CRISPR Inactive...Your CRISPR Experiment Get Started CRISPR is a powerful system that enables researchers to manipulate ...
  14. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...colonies and inoculate into a mini-prep culture. Perform mini-prep for each sample and sequence each colony...may be scaled based on the required DNA yield. Perform maxi-prep for each CRISPR/Cas9 construct. Transfecting... cell type used at limiting dilution prior to performing this step to reliably obtain approximately 30...genomic DNA isolation may be utilized to be able to perform PCR in step 6.3 . Assemble a 20 μl PCR with the...reproducibility of results. To evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene...gene 7,8 . To evaluate the protein, perform an immunoblot using an antibody against the relevant protein...
  15. CRISPR Plasmids - Plants

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target... S. pyogenes Bar Chen pBUN6I11 OsU3 BsaI yes, interfere S. pyogenes Bar Chen pBUN501 AtU6-26 BsaI yes,... pyogenes Hyg Chen pHSN6I01 AtU6-26 BsaI yes, interfere S. pyogenes Hyg Chen pHSN501 AtU6-26 BsaI yes,...
  16. Antibody Guide

    Type
    Collection
    ...signaling molecules, as some buffer components can interfere with the conjugate or conjugation process. Sodium...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ... antibody to specifically bind to a protein is powerful, but in order to utilize it in the lab, researchers...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated...protein complexes for downstream analysis. They are powerful tools for understanding protein or protein interactions...above. Reverse the crosslink, isolate DNA, and perform downstream analysis. Special considerations One...
Showing: 1 - 20 of 596 results